ID: 918580384

View in Genome Browser
Species Human (GRCh38)
Location 1:186120102-186120124
Sequence TGCCCAAGGCTGTACCAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918580384_918580387 -1 Left 918580384 1:186120102-186120124 CCCGGCTGGTACAGCCTTGGGCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 918580387 1:186120124-186120146 AAAATCAAGTTAAATGTCCAAGG 0: 1
1: 0
2: 5
3: 51
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918580384 Original CRISPR TGCCCAAGGCTGTACCAGCC GGG (reversed) Exonic
900323037 1:2094355-2094377 TGCCCAAGGTTCAACGAGCCGGG - Intronic
900996041 1:6124231-6124253 CGCCCAAGGCTGGCCAAGCCAGG + Intronic
901744428 1:11363120-11363142 TGGCCAAGGCTACACCTGCCTGG - Intergenic
902768819 1:18633925-18633947 TCTCTAAGGCTCTACCAGCCTGG + Intronic
902874746 1:19334042-19334064 TCCCCAGGGCTGTCCCAGGCTGG - Intergenic
906147289 1:43567581-43567603 TCCCCAAGGCTCTAGCTGCCAGG - Intronic
906688726 1:47778937-47778959 TGCTGGAGGCTGTCCCAGCCTGG - Intronic
906708320 1:47910963-47910985 TGCCCAAGGCTGGAATGGCCAGG + Intronic
906880293 1:49582347-49582369 TGGCCAAGGCTGTGACAGCTGGG - Intronic
908645974 1:66278319-66278341 TCCCCAAAGCTGTAGCAGCTGGG - Intronic
909466228 1:75977127-75977149 TGCCCAAGGCCATACCATTCTGG - Intergenic
910544461 1:88398362-88398384 TGCCAATGGCTCTACCAGTCTGG + Intergenic
911119404 1:94280325-94280347 TGCCAAAGGCTGTGCCAGGTTGG + Intergenic
912353639 1:109037900-109037922 TGGACAAGGCTCTACCAGCCTGG - Intronic
913308918 1:117465577-117465599 TTCCCAAGTTTATACCAGCCAGG + Intronic
915996333 1:160567855-160567877 TGCCCATGCCTGGACCATCCAGG - Intronic
918580384 1:186120102-186120124 TGCCCAAGGCTGTACCAGCCGGG - Exonic
918668800 1:187186649-187186671 TGACCAAGGCAATACCATCCTGG + Intergenic
921262915 1:213399718-213399740 TGCCCACTGCTGTAGAAGCCCGG + Intergenic
1066388078 10:34957570-34957592 TTCCCAAGGCAGGCCCAGCCAGG + Intergenic
1069855960 10:71441172-71441194 GGCCCAAGGCTGTACAAAGCAGG + Intronic
1070640603 10:78166192-78166214 TGCCCAAGGCTATGCCATCTTGG + Intergenic
1077446335 11:2592737-2592759 CGCCCAAGGCAGCAGCAGCCGGG - Intronic
1078867626 11:15312589-15312611 TGCCCATGGCTCTCCCAGGCTGG - Intergenic
1080571139 11:33558302-33558324 TACCCAAGGCTCTAACAGCTGGG + Intronic
1080821573 11:35811891-35811913 TGTCCTGGGCTTTACCAGCCTGG - Exonic
1080880757 11:36318174-36318196 TGGCAAAGGCTGTACCATCTAGG + Intronic
1081528339 11:43942302-43942324 TCCCCAAGTCTGCACCAACCGGG - Exonic
1081671382 11:44944519-44944541 TCCCCAAGACTAAACCAGCCAGG + Intronic
1083151691 11:60795619-60795641 TGCCCACAGCTGTCACAGCCTGG + Exonic
1083401812 11:62428714-62428736 TGCCCATAGCTGTAACTGCCCGG + Intergenic
1084332128 11:68436562-68436584 CGCCCAAGGCTCTACCAGGTTGG - Intronic
1085410683 11:76288658-76288680 TGCCTATGGCTCTGCCAGCCTGG + Intergenic
1086909808 11:92459167-92459189 TGCCCAGGGCTGCACCATTCAGG - Intronic
1088125729 11:106421308-106421330 TTCCCCATGCTGTACGAGCCTGG + Intergenic
1090354930 11:126133999-126134021 TGCCCAACCCGGTACCAGACAGG + Intergenic
1100480481 12:94973280-94973302 TGCAGAAGGCTGTACAAGCTAGG + Intronic
1101675850 12:106915579-106915601 TGACTAATGCTGTACCAGCATGG - Intergenic
1102056235 12:109898579-109898601 TGCCCAAGACTACACCAGCATGG + Intergenic
1107363378 13:39643493-39643515 TGGCCCAGGCTGGACCAGGCTGG - Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1110322349 13:74174532-74174554 AGACTAAGGCTGTACCAGCCAGG - Intergenic
1113882004 13:113632263-113632285 TGCCCAAAGCTTCACCAGCTAGG + Intronic
1114479795 14:23025585-23025607 TGCACAGGGCTGTACCAGGCAGG - Intronic
1116875726 14:50109661-50109683 TACCCAAGGCTCTAACAACCTGG - Exonic
1118461500 14:65991282-65991304 TGCCCAAGGGTGTGGCAGCGTGG - Intronic
1118691442 14:68344167-68344189 TGCCCATGGCTCTACCATTCTGG - Intronic
1118989963 14:70789096-70789118 AGCCAAAGGCTGTAACAGACAGG + Intronic
1119271796 14:73312336-73312358 TGACCGAGACTGCACCAGCCTGG + Intronic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1120745151 14:88145637-88145659 TGCCCCAGGCTGTTTCACCCTGG - Intergenic
1121021742 14:90584468-90584490 TGGACAGGGCTGCACCAGCCTGG + Intronic
1122775149 14:104113718-104113740 TGCCAGCGGCAGTACCAGCCAGG - Exonic
1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG + Exonic
1123703309 15:22931999-22932021 TGCCACAGGCTGTACCATCCAGG + Intronic
1126778699 15:52120138-52120160 TGCCCAAGGCTCTACACCCCTGG + Exonic
1127931358 15:63599658-63599680 TGCCCCTGGCTGTGCCAGCTCGG - Intronic
1128346300 15:66854584-66854606 AGCCCCAGGCTGCACCTGCCAGG - Intergenic
1130679014 15:85980378-85980400 TTCCCCAGGCTGTACAAGCGTGG + Intergenic
1132395734 15:101472672-101472694 TGCTGATGGCTGTGCCAGCCTGG - Intronic
1135091102 16:19518486-19518508 TGCCCAGGGCTGCACAAGCTAGG + Intronic
1135794779 16:25431433-25431455 TGCCCAGGGCTGTGGCATCCTGG + Intergenic
1136188005 16:28599449-28599471 TTCCCAAAGCTGGACCAGGCTGG + Intergenic
1136190477 16:28612443-28612465 TTCCCAAAGCTGGACCAGGCTGG + Intronic
1137397218 16:48124648-48124670 TGCAAAAGGCTGTACAACCCAGG + Intronic
1137453884 16:48603327-48603349 TGCCCTAAACAGTACCAGCCTGG - Intronic
1137896022 16:52213738-52213760 TGCCCAAGGCTGTGTCTCCCTGG - Intergenic
1140435633 16:74944636-74944658 TACCCGAGGCTGTACCACTCGGG + Intronic
1142143086 16:88481242-88481264 TGGCCAAGGCTGCACCTGCCTGG - Intronic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1143672875 17:8408553-8408575 GGCCCAAGCTTGTGCCAGCCGGG + Intergenic
1145290950 17:21545330-21545352 TTCTGCAGGCTGTACCAGCCTGG - Intronic
1151926025 17:77197661-77197683 GACCCAAGACTGCACCAGCCTGG - Intronic
1154321122 18:13353745-13353767 AGCCCAAGGCTACACCAGGCTGG + Intronic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157295162 18:46437180-46437202 AGCCCAAGGGTGGACCAGGCGGG - Intronic
1161977366 19:7613831-7613853 TTCCCATGGCTTTCCCAGCCGGG + Intronic
1162905843 19:13823425-13823447 TGGCCAAGGATGAACCAGCGGGG - Exonic
1163518414 19:17778601-17778623 TCCCCAAGGCTCTAGCAGCCTGG + Exonic
1164709158 19:30343081-30343103 GGCCCAAGGCTGTCCCCACCGGG - Intronic
1166743045 19:45125799-45125821 TGACCAAGGCTGGTCCACCCAGG + Intronic
1167282019 19:48574965-48574987 TGCGCAAGGCTGTGCTAGGCAGG + Intronic
925306122 2:2849187-2849209 TCCCCAAAGCTGTCCCACCCAGG + Intergenic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
929774638 2:44921398-44921420 TCCCCAAAACTGTGCCAGCCAGG - Intergenic
932769745 2:74493925-74493947 TGGCCAAGGTTGTAGCAGCTTGG - Exonic
934220899 2:90081758-90081780 TGCCCAAAAATGTCCCAGCCTGG - Intergenic
936562944 2:113557591-113557613 TTCTGAAGGCTGTACAAGCCTGG + Intergenic
936573695 2:113636356-113636378 TGCCCCAGGCAGTTCCAGCCTGG - Intronic
937370631 2:121295075-121295097 TGCCCATGTCTGTACCCACCTGG + Intergenic
938241009 2:129742316-129742338 CGCCCCAGGCTCTAACAGCCAGG + Intergenic
938926631 2:136049027-136049049 TGCCCAAGACTGTGCCTTCCTGG - Intergenic
939045261 2:137242551-137242573 TGCCCAAGGATGTGCCAAGCAGG + Exonic
946495607 2:220192578-220192600 TGCCCACGTCTGTTCCAGTCTGG - Intergenic
948879657 2:240850366-240850388 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879672 2:240850410-240850432 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879687 2:240850454-240850476 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879702 2:240850498-240850520 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879925 2:240851448-240851470 TGCCCAAGGAGCTGCCAGCCAGG - Intergenic
1169809788 20:9597753-9597775 TGTACAAGTCTGTACTAGCCTGG + Intronic
1171420398 20:25013857-25013879 TGCCCAGGTCTGTACCTGGCAGG - Intronic
1172973547 20:38890348-38890370 TGCACAAGGCTGCACGAGGCTGG + Intronic
1174320630 20:49739139-49739161 TGCCTGTGGCTGTCCCAGCCTGG + Intergenic
1174873527 20:54205174-54205196 TGGCCAAGGCTCCAGCAGCCAGG - Intergenic
1175925238 20:62468248-62468270 TGCCCATGGCAGTAACAGACGGG - Intronic
1176075991 20:63248431-63248453 GGCACGAGGCTTTACCAGCCTGG + Intronic
1178820028 21:35966607-35966629 TGCCCAAGGCTCTACTGTCCAGG - Intronic
1180142656 21:45901510-45901532 GGACCAGGGCTGTGCCAGCCAGG - Intronic
1180937994 22:19638529-19638551 TGGCCAAGGCTTTTCCAGCTTGG + Intergenic
1181525807 22:23485589-23485611 TGCCCCTGTCTGTGCCAGCCAGG - Intergenic
1182519190 22:30875864-30875886 TGCCCAGGCCTGTGCCAGGCAGG + Intronic
1182822080 22:33225163-33225185 TGCCCACGGCTGTAGCACCCAGG - Intronic
1183457196 22:37929349-37929371 TCCCCAAGGCGCTCCCAGCCAGG + Intronic
1184752409 22:46495128-46495150 TGCAGTAGGCTGTACCAGCTGGG - Intronic
1185426482 22:50774525-50774547 TGCCCCAGGCAGTTCCAGCCTGG + Intronic
949610904 3:5702496-5702518 TGCTCTAGGCTGTACAATCCTGG + Intergenic
950177634 3:10886354-10886376 TGCCCAAGGCTGTATGGGACAGG - Intronic
950523983 3:13513043-13513065 CCCCCAAGGCTCTCCCAGCCAGG + Intergenic
950624912 3:14238122-14238144 TACCAAAGTCTGTATCAGCCAGG - Intergenic
952925188 3:38315163-38315185 TGCTCAGGGCTGTACCACCGGGG - Intronic
953266326 3:41392602-41392624 TGCCCAAAGCTGAGCGAGCCTGG - Intronic
957588243 3:82160435-82160457 AGGCCAAGGCAGTACCATCCTGG + Intergenic
961003741 3:123391005-123391027 TGCCCAAGGCTGGGTCAGCACGG - Intronic
961738604 3:129017926-129017948 TCCTCAAGGCTGTACCAGCCAGG + Intronic
962212625 3:133491686-133491708 TGCCCAAGGCCACACCTGCCTGG + Intergenic
963483290 3:145904034-145904056 AGCCCAGGGCTGTCACAGCCTGG + Intergenic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
967572637 3:191048860-191048882 TGCCTAAGGCTGTACCCCCCCGG - Intergenic
968974817 4:3816533-3816555 TGCCCCAGGCTGGCCCAGCAGGG - Intergenic
969628987 4:8324392-8324414 TGCCCAAGGGTCTTCCTGCCAGG - Intergenic
976217808 4:82731307-82731329 TCCCCAAGGCTGTCCTAGCCAGG - Intronic
983280392 4:165673792-165673814 TACCAAAGACTGTACAAGCCTGG - Intergenic
987318972 5:16749936-16749958 TCCCCAAGGGTGTCCCTGCCTGG - Intronic
987585706 5:19853403-19853425 TGCCCAAGGCTGAACCCCCAGGG - Intronic
991958600 5:72020007-72020029 TGCCCAGGGCTGCACCACCAAGG + Intergenic
999024321 5:148208413-148208435 TGCTCAAGTCTGATCCAGCCAGG + Intronic
1001513114 5:172337381-172337403 TGCCCAAGGACACACCAGCCAGG - Exonic
1003130714 6:3393123-3393145 TGACCAAGCCTGTGGCAGCCTGG + Intronic
1003396362 6:5756182-5756204 TGCCCAATGCTGTAGCTACCTGG - Intronic
1004313127 6:14563560-14563582 AGCCCCAGGCTTTCCCAGCCAGG - Intergenic
1004571058 6:16845652-16845674 TGTCCAAGGATGTACCAGGTGGG + Intergenic
1004608757 6:17218835-17218857 TGCCCATTGCTGCAGCAGCCAGG + Intergenic
1006353587 6:33540049-33540071 TGCTGTAGGCTGTACCAGCTAGG - Intergenic
1006372871 6:33656294-33656316 GGCACAGGGCTGTGCCAGCCTGG - Intronic
1006452164 6:34111624-34111646 TGCCCATGGGAGAACCAGCCTGG + Intronic
1006531912 6:34662862-34662884 AGCCCAAGACTGGTCCAGCCTGG + Intronic
1006981560 6:38152009-38152031 TGCTCAAGCCTGTCCCTGCCTGG - Intronic
1007949015 6:45853078-45853100 TGCCCAAGGCCCTCCCAGCAAGG + Intergenic
1008306082 6:49901680-49901702 TGCCCATGGATGTACCATTCTGG + Intergenic
1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG + Intronic
1017703320 6:157096654-157096676 TGCCAGAGGCAGTGCCAGCCTGG - Intronic
1019565812 7:1678542-1678564 GGCCCAAGGGTGTCCCAGACAGG - Intergenic
1019715393 7:2536493-2536515 AGCCCACGGCTGTGCCACCCGGG + Intergenic
1019741425 7:2676647-2676669 AGCCCACGGCTGTGCCACCCAGG - Intergenic
1019992333 7:4701051-4701073 TGCCCCAGCCTGTTCCAGCAGGG + Intronic
1020136594 7:5591573-5591595 TGCCCCAGGCAATCCCAGCCAGG - Intergenic
1022206715 7:28171555-28171577 TGCCCACAGCTGCACCAGCGGGG - Intronic
1024131943 7:46362050-46362072 TGCCCACGACTGTGCCAGACAGG + Intergenic
1028360374 7:89960379-89960401 TGCGGTAGGCTGTACCATCCAGG + Intergenic
1029541858 7:101188047-101188069 TGGCCTAGGCTAGACCAGCCTGG + Intergenic
1031648156 7:124252993-124253015 TGCCCCAGACTCTACCAGTCTGG + Intergenic
1035971543 8:4254824-4254846 TGCCACAGGCTGTACCATCTAGG + Intronic
1038347648 8:26747094-26747116 TGCCCAAGGGTGACACAGCCTGG - Intergenic
1040289654 8:46117786-46117808 TCCCCAAGGCTGTCCCAGGCAGG - Intergenic
1040307210 8:46218299-46218321 CCCCCAAGGCTGTCCCAGGCCGG - Intergenic
1040334239 8:46408048-46408070 CCCCCAGGGCTGTACCAGGCGGG + Intergenic
1047799967 8:128298596-128298618 TGCCCAAGTCTGTTCCACCTGGG + Intergenic
1049611036 8:143555456-143555478 TGCCCAACTCTGCCCCAGCCAGG + Intronic
1049889788 9:58108-58130 TTCTGAAGGCTGTACAAGCCTGG - Intergenic
1052736153 9:32344691-32344713 TGCCCAAGGCTGGAACAACCTGG + Intergenic
1053731269 9:41059383-41059405 TTCTGAAGGCTGTACAAGCCTGG - Intergenic
1054697241 9:68372706-68372728 TTCTGAAGGCTGTACAAGCCTGG + Intronic
1058879101 9:109271268-109271290 TGCCCAAAGCAGGACCTGCCAGG + Intronic
1059405120 9:114094585-114094607 GGCACAAGGCTGTATCTGCCTGG + Intronic
1062028084 9:134349745-134349767 TCCCCAGGGCTGGGCCAGCCTGG + Intronic
1062086003 9:134648854-134648876 TGCCCAAGGATGCACCTTCCTGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062586860 9:137253408-137253430 TGGACAAGGCTGGCCCAGCCTGG + Exonic
1187143443 X:16616238-16616260 TGCTCACGGGTGTTCCAGCCTGG + Intronic
1188016343 X:25111892-25111914 TGCCCATGGCTCTACCATTCTGG + Intergenic
1190631219 X:52388608-52388630 AGGCCAAGGCCATACCAGCCAGG + Intergenic
1190703557 X:53006329-53006351 TGCCCATGGCTGTGCCATTCTGG + Intergenic
1198136290 X:133753934-133753956 TGTCCAAGGCTGAATCAGGCAGG + Exonic