ID: 918582065

View in Genome Browser
Species Human (GRCh38)
Location 1:186143063-186143085
Sequence AATTTGCACTAAAAAGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918582065 Original CRISPR AATTTGCACTAAAAAGTATT TGG (reversed) Intronic
903102975 1:21049176-21049198 AATGTGCCCTATGAAGTATTGGG - Intronic
904262323 1:29296350-29296372 TAATTGCAGAAAAAAGTATTTGG - Intronic
905219807 1:36437410-36437432 AACTTGCTCTAAAAAATATCTGG + Intronic
906262314 1:44403489-44403511 TATTTCTACTAAAAATTATTTGG + Intergenic
906780588 1:48569580-48569602 AATTTGTTCTAAGAAGGATTTGG - Intronic
908100325 1:60784526-60784548 CATTTGCAATAAAAATTAATTGG - Intergenic
908104632 1:60828672-60828694 AGTTTGCCTTAAAAAGTAGTGGG - Intergenic
908509710 1:64841774-64841796 AATTTGGACTATTCAGTATTAGG - Intronic
910139705 1:84013585-84013607 AATTTGCACCAGAAAGAAATGGG + Intergenic
910854561 1:91682924-91682946 AATTTGCAGAACAAAATATTAGG + Exonic
911447728 1:98019373-98019395 AATTAGCACTAGAATGTTTTAGG + Intergenic
911742356 1:101400846-101400868 AATTTGGAGAAGAAAGTATTTGG - Intergenic
913129023 1:115821362-115821384 ACTGTGCACTAAAAAGAACTAGG + Intergenic
913370137 1:118089666-118089688 AATCTGCACAGAAAAGTATTTGG - Intronic
913647522 1:120873099-120873121 ATTTTGTATTAAATAGTATTAGG + Intergenic
914079117 1:144389761-144389783 ATTTTGTATTAAATAGTATTAGG - Intergenic
914100062 1:144576741-144576763 ATTTTGTATTAAATAGTATTAGG + Intergenic
914174021 1:145258308-145258330 ATTTTGTATTAAATAGTATTAGG - Intergenic
914298926 1:146360941-146360963 ATTTTGTATTAAATAGTATTAGG - Intergenic
914637711 1:149567615-149567637 ATTTTGTATTAAATAGTATTAGG + Intergenic
915794630 1:158716182-158716204 TATTTACAGTAAAAAATATTTGG - Intergenic
916160421 1:161906474-161906496 TATTAACACCAAAAAGTATTAGG - Intronic
916316827 1:163458271-163458293 GATTAGCAGTCAAAAGTATTTGG - Intergenic
916856377 1:168754494-168754516 CATTTGGACTGAAAAGTATTGGG + Intergenic
916966413 1:169948242-169948264 TATTAGCACTAGAAATTATTTGG + Intronic
917114196 1:171585359-171585381 AATTTTCAGTGAAAAGTATATGG + Intronic
917568778 1:176240995-176241017 AATTTGCAATATACATTATTAGG + Intergenic
917798506 1:178549607-178549629 AATTTACATTAAAAAATACTAGG - Intergenic
917912249 1:179661733-179661755 AATTTGTACTAAAAGGTTTTTGG - Intronic
918254282 1:182734565-182734587 AAAATGCATGAAAAAGTATTGGG - Intergenic
918582065 1:186143063-186143085 AATTTGCACTAAAAAGTATTTGG - Intronic
919305137 1:195822619-195822641 AATTTTCACTAAATAATATTAGG + Intergenic
919574129 1:199285626-199285648 AATGTATACTTAAAAGTATTTGG + Intergenic
920088930 1:203438429-203438451 AAATTGCAGTAGGAAGTATTGGG + Intergenic
921565513 1:216712827-216712849 AATTTTCACTAAAAACAACTGGG - Intronic
921595082 1:217045866-217045888 AATTTTCACAAAAAAATCTTTGG + Intronic
922187917 1:223292781-223292803 AATGTGCACTAAAATGTCCTTGG - Intronic
923690036 1:236183412-236183434 AATTTGGACTTAAGAGTTTTGGG + Intronic
923727035 1:236515502-236515524 AATTTGCACAAAGATGCATTTGG - Intergenic
1062903601 10:1164227-1164249 ACCTTACACTAAAAAGTATCAGG - Intergenic
1063015119 10:2069044-2069066 AATTTCTACTAAAAATGATTTGG - Intergenic
1063985027 10:11493300-11493322 AATTCTCATTAAAAAGTTTTTGG + Intronic
1064213223 10:13378292-13378314 AATTTGACTTTAAAAGTATTAGG + Intergenic
1065037679 10:21656572-21656594 AAAGTGCACTAAAAAATATAAGG - Intronic
1065062430 10:21917353-21917375 AATTTGAAATAAAATTTATTTGG - Intronic
1068131279 10:52898136-52898158 TAAGTGCACTGAAAAGTATTTGG - Intergenic
1068155530 10:53192874-53192896 AATTTGTTTTAAAAAGTATAAGG - Intergenic
1068474908 10:57512550-57512572 ACTTTTCACTAAATAGTATCTGG + Intergenic
1068580461 10:58733490-58733512 AATTTCCACAGAAATGTATTGGG - Intronic
1068620721 10:59177920-59177942 CATTTACAGTCAAAAGTATTTGG - Intronic
1068829782 10:61480274-61480296 AGTTTGCACAATAAAGAATTAGG + Intergenic
1069248047 10:66232538-66232560 AATTTGCACAGAAAAGTCCTGGG - Intronic
1069479517 10:68768806-68768828 AATTTGAAATAAAAAAGATTGGG + Intronic
1070382969 10:75898126-75898148 TATTTGCTTTAAAAAGTAGTAGG - Intronic
1070924495 10:80209578-80209600 AATTTGCTCTCAAAATTATAAGG - Intergenic
1071696307 10:87876695-87876717 AATTTTCACTCACAAGAATTTGG + Intronic
1071866225 10:89735486-89735508 AATTGACTCTAAAAAGTATATGG - Intronic
1073172881 10:101527255-101527277 AATTTTCATGAAAAAGTAGTTGG + Intronic
1077944641 11:6882517-6882539 AATAGGCAATAAAAAGTTTTAGG - Intergenic
1080203389 11:29700590-29700612 TATTAATACTAAAAAGTATTAGG - Intergenic
1080967935 11:37235361-37235383 AATGTGCTCTGATAAGTATTAGG + Intergenic
1081600172 11:44487412-44487434 AATTTTCACTAAGGAGTTTTTGG + Intergenic
1083566500 11:63722683-63722705 AATTTGGATTAAAGAGTACTAGG + Intronic
1086264581 11:84982536-84982558 AGTTTGTACTAAAAGGTAGTTGG - Intronic
1086823591 11:91467576-91467598 CAATTGTACTAAAAAGTATATGG - Intergenic
1089862217 11:121599695-121599717 AGTTTGCACAAATAAGTGTTTGG + Intronic
1090515718 11:127424223-127424245 ATTTTGCACTAAAAAATTTTGGG - Intergenic
1090652284 11:128817644-128817666 ATTTTCCACTAAAAAGAACTAGG - Intergenic
1090797944 11:130151454-130151476 ACTTTTCACTAAAAGCTATTAGG + Intergenic
1091942377 12:4499688-4499710 AGTTTGCATTAATAGGTATTGGG - Intronic
1093317908 12:17674479-17674501 TATTTGTTCAAAAAAGTATTGGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1094697055 12:32830057-32830079 AATTTACATTACACAGTATTAGG - Intronic
1095120399 12:38410945-38410967 AATGAGCACTAAAATGTATTTGG - Intergenic
1095197757 12:39342550-39342572 AATTTACTCTTAAATGTATTAGG - Intronic
1096853421 12:54458675-54458697 AATGAGCACTTAAAAGTTTTGGG - Intronic
1097217908 12:57428716-57428738 ATTTTCCATTAAAAAATATTAGG + Intronic
1097417435 12:59328991-59329013 TATCTGCACAAAAAAGAATTAGG - Intergenic
1097590720 12:61571593-61571615 AATCTGAAAAAAAAAGTATTTGG - Intergenic
1097629622 12:62044234-62044256 AACTTGAACTAAAAAGCTTTCGG - Intronic
1097764007 12:63502280-63502302 AATTTGAAGTAAACATTATTTGG - Intergenic
1098013059 12:66074875-66074897 AACTTTCACTAAAATGTATCAGG - Intergenic
1098457653 12:70693278-70693300 AATTTTTAATAAAAAGGATTTGG - Intronic
1098507743 12:71274050-71274072 AATTCACATTAAAAAGTCTTTGG - Intronic
1099027753 12:77486970-77486992 TATTTGCTGTAAAAAATATTAGG - Intergenic
1099708542 12:86189297-86189319 AATTTACATTAAAATGTTTTAGG - Intronic
1100232560 12:92623105-92623127 AATTTATAATAAAATGTATTTGG - Intergenic
1100553129 12:95666098-95666120 AATTTGCTTTAAAAATCATTAGG + Intronic
1100664865 12:96740177-96740199 AATTTGGAGTAAAAAGATTTAGG + Intronic
1100677773 12:96886948-96886970 ATTTTTAACTAAAATGTATTCGG + Intergenic
1100994053 12:100282767-100282789 AATTTGTACTAAAGTGTATTGGG + Intronic
1101109768 12:101474260-101474282 AATTGGCTCAAAAAAGTAATTGG + Intergenic
1101478136 12:105071008-105071030 AATTAGAACTGAAAAGTTTTTGG + Intronic
1101601969 12:106217597-106217619 AATTTGTACTAAGAAATATTAGG - Intergenic
1101956838 12:109219300-109219322 AAGTTGCATTAATAAATATTGGG + Intronic
1102847185 12:116198116-116198138 TATATGCAGTAAAAATTATTGGG - Intronic
1102949297 12:117018944-117018966 AATATGCACTGAAAAGTACTTGG + Intronic
1103857218 12:123980968-123980990 AATTTACACTGAAAATGATTGGG + Intronic
1105747247 13:23389308-23389330 AAATTGCATTAATAAGTATTGGG - Intronic
1106047429 13:26156243-26156265 AATTCAAACTAAAAAATATTAGG + Intronic
1106260673 13:28063837-28063859 AATTTACATTTCAAAGTATTTGG - Intronic
1108451422 13:50569616-50569638 AATTGGCACCAAAAATTATGTGG - Intronic
1108888018 13:55213769-55213791 AATTTTCAGGAAAAAGTACTTGG - Intergenic
1108893097 13:55287090-55287112 AATTTGAAATAAAATGTGTTAGG + Intergenic
1109581209 13:64338569-64338591 AATTTACTGTAAAAAGTAATAGG + Intergenic
1109784100 13:67152272-67152294 AATTTGAACTAAATTGTATCAGG - Intronic
1110194449 13:72770609-72770631 AATTTACACTAAAACTCATTTGG - Intronic
1110673902 13:78215792-78215814 TATTTGCAATAATAAGAATTAGG + Intergenic
1110703656 13:78579415-78579437 AATTTTCACTATAAATTATCTGG - Intergenic
1111764926 13:92516519-92516541 AATTTGAAGAAAGAAGTATTAGG + Intronic
1112234975 13:97627506-97627528 AATGTGCACTAAAAAGAAGTTGG + Intergenic
1113539387 13:111094771-111094793 AGTTTGCCAGAAAAAGTATTAGG - Intergenic
1115401821 14:32970428-32970450 AATTAGCAATAAAAAGTAGAAGG - Intronic
1116767319 14:49088346-49088368 ATTTGGCACTAAATAGTACTTGG + Intergenic
1117238971 14:53808949-53808971 AATTTGGAATTAAAAATATTTGG - Intergenic
1117459736 14:55933472-55933494 GATGTACACTAAAAAATATTAGG - Intergenic
1117556683 14:56893457-56893479 AATTTGAACTGAATATTATTAGG + Intergenic
1119354242 14:73992143-73992165 ACTTTGCACCAAACAGTTTTGGG + Intronic
1119710441 14:76818305-76818327 AGTTTGCACTAAAAGGTCTTAGG - Intronic
1120351357 14:83363340-83363362 AATTTACATTAAACAGAATTAGG + Intergenic
1120389703 14:83889817-83889839 ACCTTGCACAAAAAAGAATTTGG - Intergenic
1120536541 14:85703031-85703053 ATTTTTCACTAAAAAGAATCTGG - Intergenic
1120603859 14:86547331-86547353 AATTTTAACTAAAAATAATTTGG - Intergenic
1120683143 14:87505417-87505439 AATTTGAAATAAAAAGTCTATGG - Intergenic
1121919155 14:97864483-97864505 AATTTGTACTAGAAGGTATCAGG - Intergenic
1202900847 14_GL000194v1_random:36823-36845 AATATTCACTAAACAGTGTTAGG + Intergenic
1125415927 15:39452565-39452587 AATTTGATCTAGAAACTATTGGG - Intergenic
1129023159 15:72542178-72542200 AATTTCCATTAAAAAATCTTTGG + Intronic
1129527138 15:76226239-76226261 AATTTGCACTACAAAGGCTGTGG - Intronic
1133934609 16:10258495-10258517 AATTTGCTCAAAAAGGAATTGGG - Intergenic
1135582745 16:23641904-23641926 AACTTGCGCTAAAAACGATTCGG + Intronic
1137331891 16:47505730-47505752 AATTTGCACTTGAAAATAATAGG + Intronic
1139656082 16:68387945-68387967 AATTTGCACAGAAAAGGCTTGGG + Intronic
1141112273 16:81279829-81279851 AACATGCAATAAAAATTATTTGG - Intronic
1142588719 17:991088-991110 GATTTGATCTGAAAAGTATTGGG - Intergenic
1146043933 17:29486325-29486347 AATTTGAGATAAAAAATATTTGG + Intronic
1146292781 17:31622668-31622690 ACTTTGCAATAAATAGTATTTGG - Intergenic
1146840939 17:36153680-36153702 AGTTTGTACTAAAGAGTAGTTGG + Intergenic
1146980294 17:37154464-37154486 AATTTTCAGTAAATAGTATTAGG + Intronic
1148523837 17:48310637-48310659 AATTTGAAACAAAAAGCATTTGG + Intronic
1149147037 17:53506469-53506491 AAGTTGTACTAAAAAATACTAGG + Intergenic
1149858592 17:60107288-60107310 AATTTGTACTAAAGAGTAGTTGG - Intergenic
1150012637 17:61520103-61520125 AATATTCAATAACAAGTATTGGG + Intergenic
1150937117 17:69648658-69648680 ATATTACACTAAAAAGCATTTGG - Intergenic
1151165492 17:72199561-72199583 CATTTGCATTAAAAAGAAGTAGG - Intergenic
1151526504 17:74672840-74672862 AATATGCACAATAAAGTTTTAGG + Intronic
1151888269 17:76936961-76936983 AATTTCTACAAAAAAGTACTGGG + Intronic
1153714595 18:7834157-7834179 AATTGATGCTAAAAAGTATTTGG - Intronic
1154003746 18:10507858-10507880 AATTTGCAACAAAAATTATGAGG - Intergenic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1155950710 18:31909990-31910012 AATTTGAATTAAGAAGAATTAGG - Intronic
1158018681 18:52814658-52814680 AATTTGTATTGAAAAGTAATTGG + Intronic
1158054510 18:53262305-53262327 AATTTGCAGAAAATAGCATTTGG - Intronic
1158356247 18:56622727-56622749 TGTTTGCATTAAAAAGTCTTAGG - Intronic
1158433622 18:57416579-57416601 AATTTTCACAGAAAAATATTAGG + Intergenic
1159512390 18:69412562-69412584 AACTTGCATTAAAAATTATTCGG - Intronic
1167994823 19:53394061-53394083 AAAGTGAAGTAAAAAGTATTTGG + Intronic
1168028506 19:53661439-53661461 AATTTGCATTAAAAAGCTTTTGG + Intergenic
1168188538 19:54719585-54719607 AATTTATTCTAAAATGTATTTGG + Intergenic
924977225 2:189418-189440 AAGTTGTGTTAAAAAGTATTTGG + Intergenic
925959067 2:8998043-8998065 AATTTGGTCCAAAAAGAATTTGG + Intronic
927333606 2:21894616-21894638 AATGTGCTATAAAATGTATTAGG + Intergenic
929384495 2:41388606-41388628 CATGTGCACCCAAAAGTATTGGG - Intergenic
932856073 2:75235203-75235225 AATTTTCAGTAAAAAGTAGGTGG + Intergenic
933029846 2:77314014-77314036 AAGTTGCATTACAAACTATTTGG - Intronic
933092806 2:78142931-78142953 AAAATGCACTTTAAAGTATTGGG + Intergenic
933549172 2:83752958-83752980 AATTTTCTCTGAAAAGTAGTAGG + Intergenic
934906026 2:98204481-98204503 AATTTGCACAGAAAAGGATTTGG - Intronic
935316580 2:101840732-101840754 AATTTGAACCAAAAAGTAATAGG - Intronic
935581792 2:104761968-104761990 ATTTTGCACCAGAAAGCATTTGG - Intergenic
936806556 2:116339640-116339662 CAGTTGCATTGAAAAGTATTGGG - Intergenic
937511170 2:122596567-122596589 GGTTTGCACTATAAATTATTTGG - Intergenic
939911920 2:147993450-147993472 AATTTTCCCTAAAAACTTTTAGG + Intronic
941116438 2:161478005-161478027 AATTTGCATTAAAAGATATATGG - Intronic
942234055 2:173887449-173887471 AAGTGGCATTCAAAAGTATTGGG - Intergenic
942543858 2:177042626-177042648 AAATTGCACTTAAAAATAATTGG - Intergenic
942637490 2:178023514-178023536 AAATTTTACTATAAAGTATTGGG - Intronic
942647277 2:178126788-178126810 AATTTACAATAAAGAGTTTTTGG - Intronic
942737530 2:179132515-179132537 AATTTACATTAAAAATAATTGGG - Intronic
942746047 2:179234381-179234403 CATTCACACTAAAAAGAATTAGG + Intronic
943313746 2:186359474-186359496 AATTAGCACTTTAATGTATTTGG + Intergenic
943376336 2:187081925-187081947 AGTTTGAACTCATAAGTATTGGG + Intergenic
943749864 2:191500266-191500288 TATTGGGACTAAGAAGTATTTGG + Intergenic
944954884 2:204797575-204797597 AAATTGCATTAAAAATTGTTTGG + Intronic
945829911 2:214771338-214771360 AAATTTCAGAAAAAAGTATTGGG - Intronic
945860915 2:215121348-215121370 AGTTTGCAATAAAAAGTTCTAGG - Intronic
946263265 2:218514995-218515017 GATATGCACAAAAAAGTATGAGG - Intronic
946786366 2:223248413-223248435 AATTTGAACTACAAATTATGTGG - Intergenic
947063166 2:226189747-226189769 AATTTGCATTAAATAGCCTTTGG + Intergenic
947725121 2:232393265-232393287 CATGTGAACTAAAAGGTATTTGG - Intergenic
948324994 2:237109410-237109432 ATTTTCCACTAAAAGGAATTAGG + Intergenic
1170249653 20:14266078-14266100 AAGTTGCAATAAAAAGTACAAGG - Intronic
1170718756 20:18856482-18856504 TAATTACACTAGAAAGTATTAGG - Intergenic
1173127888 20:40357013-40357035 AAATTGAACTAATATGTATTGGG - Intergenic
1173444594 20:43106273-43106295 CATTTGCACTGAAAAGCATGGGG - Intronic
1176620221 21:9051601-9051623 AATATTCACTAAACAGTGTTAGG + Intergenic
1177622112 21:23610218-23610240 AATTTGTACTAAAAAGAATGGGG + Intergenic
1177891843 21:26814124-26814146 AACTTGTGCTAAAAAATATTTGG - Intergenic
1178119369 21:29452349-29452371 AATTCTGACTCAAAAGTATTGGG + Intronic
1179293861 21:40043302-40043324 CAAATGCACTAAAAAGTTTTAGG + Intronic
1182228100 22:28815729-28815751 AAGTTTCACTTAAAAGTCTTGGG + Intergenic
1182561763 22:31165217-31165239 CATTTGCACTAAAATTTATGAGG + Intronic
1182971678 22:34585015-34585037 TATTTGCAAGAAAAAGTAATAGG + Intergenic
1183848810 22:40565718-40565740 AATATACAATAAAAAGTTTTTGG + Intronic
949293054 3:2487563-2487585 AATCTGTGCTAAAGAGTATTTGG - Intronic
949559702 3:5189569-5189591 AATTTTGAAAAAAAAGTATTTGG + Intronic
949700448 3:6750451-6750473 AATAAGCAATAAAAAGAATTAGG - Intergenic
951171104 3:19542895-19542917 AATTTGCAGTAAAATGTCTTAGG + Intergenic
951874863 3:27412236-27412258 AATTTGTAATAAAATGTAATGGG - Intronic
952806597 3:37360841-37360863 AATTTACCCTAAAAAGTTTTCGG - Intronic
952886235 3:38012879-38012901 AAATTGCAGAAAAAAATATTAGG - Intronic
954024867 3:47775105-47775127 AATTTTCACTTGAAAGTATATGG - Intronic
955903639 3:63784127-63784149 AATTTGAATAAATAAGTATTTGG - Intergenic
956271331 3:67450499-67450521 AATTTTCACAATACAGTATTGGG - Intronic
956915337 3:73865202-73865224 ACTTTGAACAAAAACGTATTTGG + Intergenic
957245226 3:77707998-77708020 AATCTTCACTAAAGAGTGTTAGG - Intergenic
957335260 3:78819502-78819524 TCTTTTCACTAAAAAGTATTAGG - Intronic
957730080 3:84123619-84123641 AATGTACACTCATAAGTATTTGG - Intergenic
957816515 3:85306034-85306056 AATATGCAGCAAAAATTATTAGG - Intronic
957918012 3:86710793-86710815 AATTTGCAGGAAAAAGAAGTAGG - Intergenic
958084426 3:88788195-88788217 AATTGGCTTTAAAAAGTTTTAGG - Intergenic
958163262 3:89846032-89846054 ATTTTCCACTAAAAAGAATGAGG - Intergenic
959082799 3:101820077-101820099 AATTTCCCCAAAGAAGTATTTGG + Intronic
959905126 3:111702873-111702895 AATTTGAATTATAAAATATTAGG + Intronic
960660766 3:120055831-120055853 AATTTCCACTAGAATTTATTCGG + Intronic
961122039 3:124381051-124381073 AATTTGCACTAGAAAGTAGCAGG + Intronic
961254985 3:125541957-125541979 AATTTGTACCTAGAAGTATTGGG - Intronic
961759901 3:129159234-129159256 ACTTTTCACTAAAAAGTAAAGGG - Intronic
962648937 3:137468354-137468376 AACTTGCAGGAAAACGTATTTGG + Intergenic
963097360 3:141558264-141558286 ATTTTGCACTAAAAACAACTTGG - Intronic
963219413 3:142790869-142790891 ACTTTTCACTAAAATGTTTTTGG + Intronic
963459151 3:145585691-145585713 GATTTCTACTAAAAATTATTTGG - Intergenic
963840581 3:150101297-150101319 AATTTGCCCTAAAATTTATATGG - Intergenic
964197888 3:154085573-154085595 TATTTGGTCTAAAGAGTATTTGG + Intergenic
964458924 3:156899944-156899966 AATTTGCAGAGAAAAATATTTGG + Intronic
964689123 3:159430494-159430516 AATATGCACAAAAAAGTTCTGGG - Intronic
964987969 3:162768556-162768578 AATTTGCACGAACATGTTTTAGG - Intergenic
965156572 3:165066423-165066445 AATGTGCGGTAAAAAGTATGTGG - Intronic
965272557 3:166638022-166638044 AAATTTCAATAAAATGTATTTGG - Intergenic
965306192 3:167066701-167066723 AATTTGGTATAAAGAGTATTAGG - Intergenic
965939252 3:174157604-174157626 AATTTGTAGTAAAGAGAATTTGG + Intronic
966051307 3:175620086-175620108 AATTGGAATTAAAAAGTAATAGG + Intronic
967379736 3:188843994-188844016 AAATTTCCCTAAAAAGTATTGGG + Intronic
967945205 3:194798625-194798647 AATTTGCACTGAGAAGAAGTTGG + Intergenic
968252128 3:197228687-197228709 GATTTGCACTAAAGTGTCTTAGG + Intronic
968937344 4:3618272-3618294 AATTTCAAGTAAAAAGTATGAGG - Intergenic
969936907 4:10691158-10691180 AATATGCATTAATAGGTATTGGG + Intergenic
970905570 4:21212337-21212359 CATTTGCACTCAAAAAGATTAGG + Intronic
971157548 4:24099627-24099649 AATCTGCAATCAAAAGAATTTGG - Intergenic
971544236 4:27864846-27864868 AATTTGCACTATAAAGAATGTGG + Intergenic
971935980 4:33148140-33148162 AATATGCAATAACATGTATTAGG + Intergenic
972687445 4:41364551-41364573 AATTTGCACTAAAAGTGACTTGG + Intronic
972709310 4:41578615-41578637 AATTAGCATTAAAATGTTTTTGG + Intronic
973255866 4:48112555-48112577 AATTTGTACTAAAAAATATAGGG + Intronic
973937831 4:55867832-55867854 CATTTTAATTAAAAAGTATTTGG + Intronic
974186587 4:58454916-58454938 TATTGGTACTAAAAAGTGTTGGG - Intergenic
974495572 4:62622619-62622641 ACTTTGCACTATATATTATTGGG - Intergenic
974943502 4:68497264-68497286 TATTGGCACAGAAAAGTATTAGG + Exonic
974962204 4:68717481-68717503 AATTAACAATAATAAGTATTTGG + Intergenic
975268174 4:72395953-72395975 TATTTGAAACAAAAAGTATTAGG + Intronic
975871201 4:78780505-78780527 ATTTTGCACTATAAATTAGTAGG + Intronic
976203882 4:82606414-82606436 AATTTGTACTAAGAAGCACTGGG - Intergenic
976351640 4:84066539-84066561 AATTTGCAATATAAACTATAGGG + Intergenic
976534475 4:86195005-86195027 ATTGTGGAGTAAAAAGTATTAGG + Intronic
977291181 4:95166325-95166347 AATTTGTAGTGAAAATTATTTGG + Exonic
977476436 4:97516342-97516364 AATTTGCACTTAAAATGAATGGG - Intronic
979479430 4:121199357-121199379 AGTTTGCACTTAAAAGAAGTCGG + Intronic
979961592 4:127027045-127027067 AATGTACACAAAAAAGTAATGGG - Intergenic
980295231 4:130905787-130905809 AAATTCCCCTAAAAAGTAATTGG + Intergenic
981978108 4:150756278-150756300 AAAATGCTCTAAAAAATATTTGG + Intronic
982096581 4:151928908-151928930 CATTTTCACTACAAAATATTAGG - Intergenic
982853494 4:160349757-160349779 CAGCTGCATTAAAAAGTATTTGG + Intergenic
983085544 4:163440034-163440056 ATTTTGAATTAAAAAATATTTGG - Intergenic
983510603 4:168605934-168605956 AATTTGCCCTAAAAAAAAATTGG - Intronic
983984700 4:174044250-174044272 AATTTGTATTATAAAATATTTGG + Intergenic
986248885 5:6037406-6037428 AATTTGCACGAGAAAATATCTGG + Intergenic
986532526 5:8753961-8753983 AATTTGTACTAAGAAGAATTAGG + Intergenic
987558384 5:19484898-19484920 ATTTTGCACTAAAAAGTAAGTGG + Intronic
987571478 5:19666988-19667010 ATTTGGCACTTAAACGTATTTGG + Intronic
988072439 5:26310414-26310436 AATTTTGAATAAAAAGTATTGGG + Intergenic
988932971 5:36054973-36054995 AATTTGGACTAAAAGGTATGAGG - Intronic
989172130 5:38482481-38482503 CATTTTAATTAAAAAGTATTGGG - Intronic
989414841 5:41161884-41161906 AATTTGCACTAAAATTAAATGGG - Intronic
991485274 5:67129060-67129082 AATTGGCTCTATAAAGTATTTGG + Intronic
992640356 5:78763570-78763592 AATATGCCCTAAAAAGAGTTAGG - Intronic
992643387 5:78789665-78789687 AATTTGTACTATAAAGCATTTGG + Intronic
992968215 5:82025742-82025764 ATTTTGGACTAAAAAGCTTTAGG + Intronic
993356145 5:86910570-86910592 ACTTTGCACAAGAAATTATTTGG + Intergenic
994522805 5:100862700-100862722 AATGTTCAATAAAAGGTATTCGG - Intronic
996259868 5:121453801-121453823 TATTTGCAATAAAAACTATGGGG - Intergenic
996363134 5:122672603-122672625 AATTTGGACAAAATAGTATAGGG + Intergenic
998595886 5:143529936-143529958 GATTTGCACTAAAGAGCAATGGG + Intergenic
998968021 5:147561845-147561867 AAATTATTCTAAAAAGTATTTGG - Intergenic
1000717728 5:164667540-164667562 AATATACACTCAAAAGTATAAGG + Intergenic
1001253208 5:170164584-170164606 AATTTGCAAAAAAATGCATTTGG + Intergenic
1001697980 5:173686548-173686570 CATTTGGAATAAAATGTATTGGG + Intergenic
1002980375 6:2130074-2130096 ATTTTGCACTAAAAAATACCGGG + Intronic
1005166076 6:22922698-22922720 AATTTTCCCAAAAAAGCATTGGG + Intergenic
1005494103 6:26373939-26373961 ACCTTGCTCTAAAAAGAATTTGG - Intronic
1005503350 6:26449288-26449310 ACCTTGCTCTAAAAAGAATTTGG - Intronic
1005808074 6:29493738-29493760 ACTGTGCACTTAAAATTATTAGG + Intergenic
1007490127 6:42214404-42214426 AATTTCCACTAAAAACTAAAAGG + Intronic
1008085339 6:47238613-47238635 AGTTTGGACTAATAAGTATCTGG - Intronic
1008445505 6:51585029-51585051 AATGTGCATTCCAAAGTATTAGG + Intergenic
1008651267 6:53565442-53565464 AATTTGCAGTCAAAAGAAATGGG - Intronic
1008972446 6:57385453-57385475 AATAAACACTAACAAGTATTGGG - Intronic
1009161355 6:60286980-60287002 AATAAACACTAACAAGTATTGGG - Intergenic
1009340146 6:62543999-62544021 AGTTTGCATTTAAAAGTTTTTGG - Intergenic
1009378398 6:62999709-62999731 AATTTGCACCTTAAATTATTAGG + Intergenic
1009469215 6:64010765-64010787 AATCTTCGCTAAAAGGTATTTGG + Intronic
1009515782 6:64615312-64615334 CATTTGCACTAAAGATTAGTGGG + Intronic
1009684501 6:66938058-66938080 AATTTGCAATGAAAAGTCCTTGG - Intergenic
1010429897 6:75766908-75766930 AATTTGAAATAAAAAGTTCTTGG + Intronic
1010903253 6:81453827-81453849 AAATAACAATAAAAAGTATTTGG - Intergenic
1011175306 6:84553041-84553063 AATTTGCACTGGGAAGTACTGGG + Intergenic
1012843413 6:104359439-104359461 AATATGCAATAAAAAATATCAGG + Intergenic
1014435126 6:121412081-121412103 AATTTACAGCAATAAGTATTGGG + Intergenic
1014684070 6:124473138-124473160 AATTTGTACTAAAAAGGACCAGG + Intronic
1014910454 6:127086616-127086638 CATATGCATTAAAAAGTATATGG - Intergenic
1014983461 6:127973869-127973891 AATTTTTACTAAAAAGTAAAAGG + Intronic
1016137530 6:140563167-140563189 AATTTACACTAAGAAACATTAGG - Intergenic
1016370822 6:143372120-143372142 AATTTGCTCTAAAAACTCTTCGG - Intergenic
1017932728 6:158973475-158973497 AACTTGCAGAAGAAAGTATTTGG - Intronic
1018879679 6:167864606-167864628 ACTTTGCAACAAAATGTATTCGG + Exonic
1019227575 6:170526840-170526862 GAGTTTCACTAAAAATTATTGGG - Intergenic
1019691670 7:2418299-2418321 AAATGGCACTGAAAATTATTAGG - Intronic
1020401951 7:7788945-7788967 AATTTAAAATATAAAGTATTAGG - Intronic
1020562314 7:9744593-9744615 TATTAGTACTAAACAGTATTTGG - Intergenic
1020652442 7:10891776-10891798 AATTACCACTGAAAAATATTGGG - Intergenic
1021033358 7:15766151-15766173 AATTTGAACAAAAAAATAATTGG - Intergenic
1021242983 7:18227620-18227642 AATTTACACCAGAAAGTCTTTGG + Intronic
1021343283 7:19489958-19489980 AATGTCCACTAAATAGTAATAGG + Intergenic
1021995184 7:26172420-26172442 AATATACACTAATAAGTATCTGG - Intronic
1023291216 7:38670847-38670869 AAATCGCACCAAAAAGTAATGGG - Intergenic
1023407166 7:39846477-39846499 AACTGGCACTAAAATCTATTTGG - Intergenic
1023766454 7:43515608-43515630 TCTTTGCACTGATAAGTATTTGG - Intronic
1026301945 7:69105748-69105770 ATTTTGCACAAGAAAGAATTTGG - Intergenic
1026464453 7:70641905-70641927 AATGTGCACTATAGAATATTCGG - Intronic
1027899002 7:84084645-84084667 AATTTGAACTTGCAAGTATTTGG + Intronic
1028278604 7:88891980-88892002 AATTTGCACATGAAAATATTTGG - Intronic
1028323710 7:89495564-89495586 AATATGCAATGAAAAATATTGGG - Intergenic
1029228581 7:99047350-99047372 AACTAGCACTAAAAAATAGTGGG - Intronic
1030041479 7:105454490-105454512 AATTTGCACTTAAAAAAATAAGG - Intronic
1030870058 7:114745017-114745039 AAGTTGCAGTATAAAGTATGAGG - Intergenic
1032308933 7:130764253-130764275 TATTTGCAATAAATAGTGTTGGG - Intergenic
1033754411 7:144386142-144386164 TATTTGCATTAACAAATATTAGG + Intergenic
1034055331 7:148028683-148028705 AATTTGTACTAAAAAGAATCAGG + Intronic
1038228461 8:25678718-25678740 AAGATGCACAAAAAAGAATTAGG + Intergenic
1038231785 8:25707235-25707257 GTTTTGCACTAAAGAGTGTTTGG - Intergenic
1040739454 8:50555308-50555330 AGTTTCCATTCAAAAGTATTAGG + Intronic
1043697441 8:83237931-83237953 GATGAGCACTAAGAAGTATTAGG - Intergenic
1044032858 8:87260185-87260207 AATTAGCTCTAAAAATTATCTGG - Intronic
1044048955 8:87475212-87475234 AATTTGAACTAAAAATTGATAGG + Intronic
1044269604 8:90226159-90226181 AATTTGAATGAAAAAATATTAGG + Intergenic
1044688520 8:94852956-94852978 AAATTGCTCTAAAAATTAGTTGG + Intronic
1044807393 8:96021960-96021982 AATTTGCACCAAAAAGTAATGGG + Intergenic
1044917873 8:97135163-97135185 AACTTGGGCTAAAAAGTTTTAGG - Intronic
1044983121 8:97735727-97735749 AATTTGAACTAAAAAGAACATGG - Intergenic
1045163497 8:99576324-99576346 AATTTGTACTAAAAATAACTTGG - Intronic
1045917951 8:107495661-107495683 AATTCTCACTAAAAACTATACGG + Intronic
1047379395 8:124344273-124344295 AATTTGCACTATAAAATAAAGGG + Intronic
1049081000 8:140443487-140443509 ATTTTGCACTACAATGTTTTGGG + Intronic
1050004429 9:1114904-1114926 ATTTAGCTATAAAAAGTATTTGG + Intergenic
1050257203 9:3807555-3807577 AGTCTGTACTAAAAAGTTTTGGG + Intergenic
1050501898 9:6307370-6307392 AATTTGGGAGAAAAAGTATTTGG - Intergenic
1051221648 9:14854991-14855013 AATTAGAACTATAAATTATTTGG - Intronic
1052086939 9:24279402-24279424 AGCATGCAATAAAAAGTATTAGG - Intergenic
1052843778 9:33316471-33316493 AATTTGTACAAAAAAGACTTGGG - Intronic
1055277063 9:74629974-74629996 AATTTGACCTTAAAAGTAGTGGG - Intronic
1055736066 9:79332382-79332404 AATTTTCACTTACAAGAATTTGG + Intergenic
1057374365 9:94505436-94505458 ATTTTTCACTAATAAGTATAAGG - Intergenic
1058339419 9:103876049-103876071 AATTTGCTCTAAAAACTACTGGG - Intergenic
1058959248 9:109977565-109977587 AAATTACACCAAAAAGTAATTGG + Intronic
1059986595 9:119826068-119826090 ACTTTGCAATCAAAAGAATTTGG - Intergenic
1060060902 9:120458620-120458642 AATCTGCAAATAAAAGTATTTGG + Exonic
1060316931 9:122520218-122520240 AATTTGCACTAAAGAGGAAAAGG - Intergenic
1060499496 9:124142229-124142251 AACTTGCACAAGAAAGAATTTGG - Intergenic
1061740472 9:132700726-132700748 CATGTGAACTAAAAAGCATTTGG - Intergenic
1186631161 X:11350345-11350367 AATTTTCCCTTAAAAATATTCGG + Intronic
1186847215 X:13542650-13542672 AATTTGCTCTAACGAGTTTTGGG - Intergenic
1187012556 X:15294774-15294796 TATTTTTACTAAAAAATATTTGG + Intronic
1187540809 X:20192319-20192341 AATTTTCAATAAATGGTATTTGG + Intronic
1188319624 X:28720518-28720540 CATTTGCAATAACAAGTAGTAGG - Intronic
1188833870 X:34932840-34932862 AATTTGCATAATAAAATATTAGG + Intergenic
1188838778 X:34989757-34989779 AAGTTCCACTAAAAAGGATACGG + Intergenic
1189217657 X:39340833-39340855 AGTTTGAACTAAAAATTCTTTGG + Intergenic
1189851498 X:45181362-45181384 AAATGGCACTAAAATTTATTTGG + Intronic
1190748623 X:53342110-53342132 AATATCAACTAAAAATTATTTGG + Intergenic
1192776142 X:74247460-74247482 ATTTTTCAGTAAATAGTATTGGG + Intergenic
1192851684 X:74963170-74963192 AATTGGCAAAAAAAAATATTTGG - Intergenic
1193707556 X:84841193-84841215 AATTTGAACTAAAAATCATAAGG - Intergenic
1193725437 X:85033229-85033251 ACTATGCACCAGAAAGTATTTGG - Intronic
1193810934 X:86050121-86050143 CATTTGAAATAAAAGGTATTTGG - Intergenic
1194128450 X:90049133-90049155 CATTTGCACTTACAAGTATTAGG + Intergenic
1195436482 X:104849801-104849823 CATGTGAACTAAAAAGCATTTGG + Intronic
1195721153 X:107870169-107870191 TATTTGGAATAAAAAGTGTTTGG + Intronic
1197571332 X:128154367-128154389 AATTTGAAAAAAAAAGTATGTGG + Intergenic
1197968250 X:132088193-132088215 AATTTGCACTGAAAAGAAGGTGG + Intronic
1198695146 X:139328002-139328024 AATCTGCACTATAAACTATATGG + Intergenic
1198930885 X:141858714-141858736 AATATGCAGTAATATGTATTCGG - Intronic
1198949724 X:142057104-142057126 AACTTTCAATAAAAAGTTTTCGG + Intergenic
1199008101 X:142726297-142726319 ATTTGACACTTAAAAGTATTGGG - Intergenic
1201903584 Y:19067352-19067374 AATATGCACATAGAAGTATTAGG + Intergenic