ID: 918584615

View in Genome Browser
Species Human (GRCh38)
Location 1:186171428-186171450
Sequence GCTCAAAGGCAGAAAATGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918584609_918584615 17 Left 918584609 1:186171388-186171410 CCATAGGAAGTTTCCATTGTGGA 0: 1
1: 0
2: 1
3: 12
4: 158
Right 918584615 1:186171428-186171450 GCTCAAAGGCAGAAAATGCATGG 0: 1
1: 0
2: 3
3: 37
4: 319
918584612_918584615 4 Left 918584612 1:186171401-186171423 CCATTGTGGATGTGAACCTGGGT 0: 1
1: 0
2: 1
3: 19
4: 223
Right 918584615 1:186171428-186171450 GCTCAAAGGCAGAAAATGCATGG 0: 1
1: 0
2: 3
3: 37
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918584615 Original CRISPR GCTCAAAGGCAGAAAATGCA TGG Exonic
902579010 1:17396715-17396737 GGTCACAGGCAGAAAGTGCCAGG + Intronic
903288536 1:22292267-22292289 GCTCAAAGGCAGAAATGGAGGGG - Intergenic
903498100 1:23785072-23785094 GGTCACATGCAGCAAATGCATGG - Intronic
904329573 1:29749498-29749520 GCACAGAGGCAGAGAAAGCAGGG + Intergenic
904797930 1:33071475-33071497 GCTCAAAGGCAGAGCTTGCCGGG - Intronic
905822826 1:41007057-41007079 GCTCAAAGGCAAGGGATGCAGGG - Intronic
906274835 1:44507886-44507908 GCTCAAAGGGAGAAAAAGAAGGG - Intronic
908155812 1:61351643-61351665 ATTCAAAGACAGAAAATGCAAGG + Intronic
908945376 1:69489789-69489811 CCCCAGAGGCAGAAAAAGCATGG + Intergenic
909039940 1:70637365-70637387 CCTCAAAGGCAGAAAATCTGAGG + Intergenic
909471618 1:76035296-76035318 TCTCAAAGGCAAACAATGCAAGG - Intergenic
911750720 1:101494001-101494023 GTTGAAAAGCAGCAAATGCAGGG - Intergenic
914450455 1:147786952-147786974 GCTCAAAGGCAGAGCATGGCAGG + Intergenic
916683437 1:167124298-167124320 GGTCAGAGACAGAAAATTCAGGG - Intronic
917431352 1:174972904-174972926 GCTCAAAGGTAGAATTTGAAAGG + Intronic
918584615 1:186171428-186171450 GCTCAAAGGCAGAAAATGCATGG + Exonic
920394953 1:205638289-205638311 GCTCAGAGGCACAAACTGCCTGG + Intergenic
920851804 1:209633069-209633091 ACTCAAAGTCAAAAAATTCAAGG - Exonic
921572578 1:216796767-216796789 GCTCAAAGCCAGAAACTTCTTGG + Intronic
1063225463 10:4011397-4011419 GCCACCAGGCAGAAAATGCATGG - Intergenic
1063846586 10:10135322-10135344 GCTCAAGGGGAAAAAAAGCATGG + Intergenic
1063903901 10:10763559-10763581 GCAGAAAGGAAGAAAATGGAAGG + Intergenic
1063990303 10:11554206-11554228 GCTCAGAGGAAGCAAATTCAAGG + Intronic
1069053724 10:63821821-63821843 GCACAAGGACAGAAAATGTAAGG - Intergenic
1070615717 10:77967912-77967934 GCCCGAAGGCAGAAAATGTGGGG + Intergenic
1071497418 10:86178710-86178732 TCTCAAAGGCAGAAAGGGCCAGG - Intronic
1072787459 10:98293975-98293997 GCTCAAAGGTGAAAAATGCAGGG - Intergenic
1074464023 10:113666295-113666317 GTTAGAAGGCAGGAAATGCAGGG + Intergenic
1075094265 10:119460780-119460802 CCTCAAGGGCAGAAGATGCAGGG + Intergenic
1075162572 10:120037489-120037511 GCTTTAAGGCAGAAAATGAGAGG + Intergenic
1075934906 10:126332030-126332052 GCTCAAAGGCAGAATAGCCCAGG + Intronic
1077850074 11:6067456-6067478 ACTCCATGGCAGAGAATGCATGG + Intergenic
1077995203 11:7446802-7446824 GCTCACAGACAGAAAGGGCAGGG - Intronic
1078006972 11:7539556-7539578 TCTAAAAGGGAGAAAATGAAAGG - Intronic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078397401 11:10993251-10993273 GGTCCAAGGCAGAAGCTGCAAGG + Intergenic
1078649657 11:13176950-13176972 CCTGAAAGGCAGTAAATGCTGGG + Intergenic
1078949512 11:16113935-16113957 GCTCAAAAGAAGAAATTTCATGG + Intronic
1080491578 11:32770253-32770275 GTTCAAAGGTAGAAACTGCAAGG + Intronic
1080638652 11:34145354-34145376 TCTCAAAGGAAGAAAAAGAAAGG - Intronic
1081685226 11:45037785-45037807 GGGCAAAGGCAGAAACTGAATGG - Intergenic
1082903501 11:58282440-58282462 GGTCAAAGGCAGATAAATCAAGG - Intergenic
1083395757 11:62390702-62390724 TCTCAAAGGCAGATAATCCCTGG - Intronic
1084616665 11:70240935-70240957 GCTCAGAGGCAGGAAAGTCATGG - Intergenic
1085282778 11:75341799-75341821 GCTCAAGGGCAGGACATGCTTGG + Intronic
1085648971 11:78250156-78250178 GCCGAAGAGCAGAAAATGCAAGG - Exonic
1085777950 11:79383057-79383079 GCAGAAAGGCAGAAGATGGATGG - Intronic
1086164839 11:83765682-83765704 TCTCATAGGCTGAAAAAGCAAGG - Intronic
1086423451 11:86660584-86660606 GCTCAAAGGCTAAAAATCGAGGG - Intronic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1086449333 11:86900554-86900576 GCTCAGAGCCAGACCATGCAGGG - Intronic
1086502588 11:87468757-87468779 GCTTAAAGGCAGAAAATCTGTGG - Intergenic
1086618045 11:88847608-88847630 GCCAAGAGGCAGAAACTGCAGGG + Intronic
1086646733 11:89231539-89231561 ACACAAAGACAGAAACTGCATGG + Intronic
1086917303 11:92545668-92545690 GCTCAAGGGTAGAAAAGGCAAGG + Intronic
1088297218 11:108312752-108312774 GTGCTATGGCAGAAAATGCATGG - Intronic
1088899074 11:114101397-114101419 CCTCAACGCTAGAAAATGCAGGG - Intronic
1089374476 11:117984933-117984955 TCTGAAATGCAGAAAAGGCAAGG + Intergenic
1089845974 11:121458761-121458783 GCTAAAATCCAGAAAAGGCAGGG + Intronic
1092008149 12:5086944-5086966 GGCCAAAGGCAGGAAAAGCAGGG + Intergenic
1092123586 12:6060843-6060865 GATCAAGGGGAGAAAGTGCATGG + Intronic
1092134668 12:6138352-6138374 GTTCAAAGGCAGGAAAAGCGGGG - Intergenic
1092464481 12:8718025-8718047 GCACAGAGGCTGAAAATCCAAGG - Intronic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1094530027 12:31265726-31265748 GATAAAAGTCAGAAAAAGCAAGG + Intergenic
1095824614 12:46517965-46517987 GCCTAAAAGCAGAAAATACATGG + Intergenic
1096222091 12:49836905-49836927 GCTGTAAGGCAGACAATGGATGG + Exonic
1096627835 12:52906223-52906245 GCTAGAAGGCAGAGAACGCAGGG + Intronic
1096718773 12:53506185-53506207 GCCCAGAGGCAGAAAGAGCAGGG - Exonic
1096823874 12:54259466-54259488 CCCCAAAGGTAGAAAATGAATGG + Intronic
1097782419 12:63723524-63723546 GCACAAAAGAAGAAAATGTATGG + Intergenic
1097925152 12:65119108-65119130 GCTGAAAAGGAGAAAATGAAAGG + Intronic
1098477331 12:70920624-70920646 GCTCAGAGGCGGCAAATGCCTGG + Exonic
1098918970 12:76285590-76285612 GCCCAAAGGCAGACTCTGCAGGG - Intergenic
1099657484 12:85512092-85512114 GTTCAAAGATAGAAAATTCAAGG - Intergenic
1101011886 12:100459216-100459238 GCTCAAAGGCAGAATAAACAGGG + Intergenic
1102385606 12:112506869-112506891 GCTCAAAAGCAGAAATGGCCAGG + Exonic
1102590166 12:113950771-113950793 GATTAAAGGCAGAAAACCCAAGG - Intronic
1103583366 12:121933188-121933210 GCTCTAAGGGAGAAAAATCAGGG + Intronic
1104796326 12:131521808-131521830 GCAAAGAGGGAGAAAATGCAAGG + Intergenic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1105774901 13:23649574-23649596 GCTAAAAGGTAGCAAATGAAAGG - Intronic
1106434850 13:29714404-29714426 GGTCAAAGCCTGAAAATGCAGGG - Intergenic
1106568275 13:30905773-30905795 GCTGAAAGGAGGGAAATGCAGGG + Intergenic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1106899854 13:34344025-34344047 GCTCTGAGGCAGAAAAAACAGGG + Intergenic
1109532510 13:63668851-63668873 CTCCAAAGGCAGAGAATGCAGGG + Intergenic
1109752796 13:66718580-66718602 GCTAAAAGGCAAAAAATAAAAGG + Intronic
1110192131 13:72742278-72742300 GATAAAAGGAAGAAAAAGCAAGG - Intronic
1111493754 13:89020854-89020876 GCTAAAATGCAGAAAATACCAGG - Intergenic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1115025159 14:28735777-28735799 GCTCAAGGGCTGAAAATTAATGG + Intergenic
1115195964 14:30799655-30799677 GTTCTAAGGCAGAAGTTGCAAGG - Intergenic
1116282526 14:42927397-42927419 ACTCAAATTCAGGAAATGCAGGG - Intergenic
1116976645 14:51123959-51123981 TCCCAAAGGAAGAAAATGAAGGG + Intergenic
1117661098 14:58005793-58005815 GAGCAAAGGCAGAAAAGACAAGG + Intronic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1118924721 14:70181651-70181673 GCACAAAAGCAGAAAGGGCAAGG + Intronic
1118927682 14:70207639-70207661 CTTCAAAGGCATAAAATTCAGGG + Intergenic
1121731826 14:96192777-96192799 GCTCAGAGGCAGAGAATGCCAGG + Intergenic
1122170795 14:99873053-99873075 GAAAAAAGGCAGAAAATCCAGGG + Intronic
1122864082 14:104595669-104595691 TCTCAGAGGCAGGAGATGCAGGG + Intronic
1123508904 15:20975361-20975383 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123566126 15:21549110-21549132 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123602386 15:21986397-21986419 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123999432 15:25742473-25742495 GATGAAAGGCAGAAAAGGCAAGG - Intronic
1124506590 15:30281868-30281890 GCTGAAAAGCAGTAAAGGCAGGG + Intergenic
1124736967 15:32256768-32256790 GCTGAAAAGCAGTAAAGGCAGGG - Intergenic
1125104415 15:35953943-35953965 GCTGATAGACAGAAAATTCAGGG - Intergenic
1127365124 15:58282394-58282416 GGTCAAAAGCAGAAGCTGCAAGG + Intronic
1127835466 15:62787557-62787579 GCTCAAAGACATAAAATGTGGGG - Intronic
1130274061 15:82467421-82467443 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1130497855 15:84478741-84478763 ACCCAAAGGCAGAACATGAAGGG - Intergenic
1130588703 15:85199388-85199410 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1131455146 15:92577753-92577775 GCTCCAAGGCAGAAAATAAAAGG + Intergenic
1202974493 15_KI270727v1_random:276200-276222 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1133202675 16:4213833-4213855 CCTCTGAGGCAGAAAAAGCAAGG + Intronic
1133743610 16:8670509-8670531 GCAGAATGGCAGAAAATGCAAGG + Intergenic
1133963140 16:10511741-10511763 GGTGAAAGGCAGGAACTGCAAGG - Intergenic
1134144406 16:11748645-11748667 GCTGAAGCACAGAAAATGCAGGG + Intergenic
1134625470 16:15719797-15719819 GGTCAACTGCAGAAAATCCAAGG - Intronic
1135273480 16:21088952-21088974 GATCAAAGGCAGATAATAAAGGG + Intronic
1135275435 16:21108409-21108431 GCTTAAGGGAAAAAAATGCATGG + Intronic
1135561570 16:23480604-23480626 GCCCCAAGGCAGAGAAGGCAAGG + Intronic
1135630291 16:24031289-24031311 GCCCAAAGGGACAAAATTCAAGG + Intronic
1135865818 16:26100927-26100949 GCTCAAAGGCAGGAGATGAAAGG + Intronic
1137608175 16:49800855-49800877 GCTCAAAGGCAAAACAGGGAAGG + Intronic
1137626787 16:49914108-49914130 GATCAAAGGCAAAAAATGAAAGG + Intergenic
1137926442 16:52546505-52546527 GCTCAAAGGTAGAAGAGACATGG + Intronic
1138925444 16:61584826-61584848 GATGAAAGGAAGAAAATGAACGG + Intergenic
1141332975 16:83128994-83129016 CTTCAAAGGCATAAAAAGCAGGG - Intronic
1142145060 16:88489454-88489476 CCTCAGAGGCAGGAAAGGCAGGG + Intronic
1144038375 17:11387279-11387301 GGTCTAAGGCAGAAAGTTCAGGG + Intronic
1144387369 17:14761286-14761308 ACCCAACGGCAGAAAATGCCAGG - Intergenic
1144782773 17:17816201-17816223 ACTCACTGTCAGAAAATGCAAGG + Exonic
1146796917 17:35788211-35788233 CCTTAAGGGCAGAAAATGAAAGG - Intronic
1148457276 17:47817848-47817870 GCTCAAAGGCAGCAAAGGTGAGG - Intronic
1149338365 17:55661001-55661023 GCTCTAAAGCAGACAAGGCAGGG - Intergenic
1149420782 17:56509271-56509293 GCTCAAAAGGAGACAATTCAAGG + Intronic
1152689189 17:81710239-81710261 GCTCCAAAGCAGAAAGAGCAGGG - Intergenic
1153122366 18:1744364-1744386 GCACACAGGTAGAAAATACAGGG - Intergenic
1153206439 18:2708349-2708371 TCTAAAAGGCAGAAAAGGCAAGG - Intronic
1156153933 18:34279377-34279399 TCTAAAAGCCAGAAAAGGCAAGG + Intergenic
1156228151 18:35129259-35129281 GCTCCAAGACAGAAAAAGGAGGG - Intronic
1156385482 18:36600869-36600891 GCTCAAAGGAAGAATGTGCAGGG - Intronic
1156392466 18:36663731-36663753 GCCAACAGGCAGGAAATGCATGG - Intronic
1156660528 18:39340997-39341019 GAACAAAGGCAGATAATGGATGG - Intergenic
1156738577 18:40295386-40295408 GCTTAAAGACAGACAATTCAAGG + Intergenic
1157339062 18:46762989-46763011 GTTCAAAGACTGAAAAGGCACGG + Intergenic
1157516273 18:48313861-48313883 GATCATAGGCAGAACATGAATGG + Intronic
1158757627 18:60345773-60345795 GCTCAAATGTTGAAAATGCCAGG + Intergenic
1159469949 18:68839621-68839643 GCTCAAAGGCTGGCAATGCATGG + Intronic
1160369224 18:78357631-78357653 GCTCAAAGGAAGAAAATTAGAGG + Intergenic
1164557402 19:29264094-29264116 GCACAAAGGCAGAAATTCCCTGG - Intergenic
926955541 2:18291301-18291323 GCTCATAGTCAGAAAAACCAAGG - Intronic
927828507 2:26327396-26327418 GCTCAAAGGGAAATAATGAAAGG - Intronic
928521744 2:32095806-32095828 ACTCAAAGGCAAGAAAAGCATGG + Intronic
928537298 2:32253069-32253091 GCTCACAGGAAAAAAATGCATGG - Intronic
929390857 2:41466896-41466918 GGTCAAACTCAGAAAATGAAAGG - Intergenic
929546745 2:42860838-42860860 GGTCAAAGGCTGGAAATTCAGGG - Intergenic
931761315 2:65419528-65419550 ACTCAAAGGGAAAAAATTCAGGG + Intronic
931916754 2:66964388-66964410 GAGCAGAGGCAGAAAATGAAAGG - Intergenic
935519047 2:104081503-104081525 CCACAAAGGCAGAAAAAGCATGG - Intergenic
936622218 2:114112213-114112235 TCTGAAAGCCAGAAAAGGCAAGG - Intergenic
936895234 2:117420307-117420329 TCTCAAAGCCAGAAAAGGAAGGG - Intergenic
937246984 2:120499935-120499957 GCTCAAAGGCATGGAGTGCAGGG - Intergenic
937821195 2:126313080-126313102 ACACAAAGGCAGAGAAAGCAAGG + Intergenic
939444424 2:142290425-142290447 ACTCCAAAGCAGAAAATGAAAGG + Intergenic
940599491 2:155840091-155840113 TCTGAAAGGCAGCAAATACATGG - Intergenic
940761956 2:157748554-157748576 CATCAAGGGCAGAAACTGCAAGG + Intronic
941586599 2:167366910-167366932 GCACAAAGGCAGAAGGTGCCAGG + Intergenic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
943791491 2:191937610-191937632 GCTCAGAAGTAGAAAATGCATGG + Intergenic
946268414 2:218568669-218568691 GCTCAAAGCCAGAAGTTGCGGGG + Exonic
946836157 2:223774599-223774621 GCTCAGAGGCATAAAAAGCCAGG + Intronic
946992738 2:225353473-225353495 TCTCAAAGGCAGAGAATGATGGG + Intergenic
948114313 2:235482860-235482882 TCTAAAAGCCAGAAAAGGCAAGG + Intergenic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
948795138 2:240398826-240398848 GCTCAGAGGGAGAAAATGAGGGG - Intergenic
948903682 2:240968060-240968082 GGTCACAGGCAGGCAATGCAGGG - Intronic
1168753418 20:299143-299165 GCCCAAAGGGTGAAAATCCAGGG - Exonic
1169100840 20:2947308-2947330 GGCCAAAGACAGAAAATACAAGG - Intronic
1169362714 20:4964655-4964677 GCACACATGCAGAAAATGAAGGG + Intronic
1172004819 20:31811857-31811879 GCTCAAATCCAGAAAAAGCCAGG - Intergenic
1178165222 21:29966793-29966815 GCACAAAGGGAGAACATGGAGGG - Intergenic
1179081961 21:38179593-38179615 GCTCAGAGGCAGAAAATACTTGG + Intronic
1180044179 21:45295412-45295434 GCTAAAAGGCAGGCAATGGATGG - Intergenic
1181899207 22:26138869-26138891 TCACACAGCCAGAAAATGCAGGG - Intergenic
1182160559 22:28116913-28116935 ACTCACAGGCAGAAGAGGCAGGG - Intronic
1182398883 22:30059077-30059099 ACACAAAGGCTGAAAATGAAAGG + Intergenic
1183305658 22:37081740-37081762 ACTGAAAGGCAGAAAAGACAGGG + Intronic
1184341291 22:43887513-43887535 GCTCAAAGGCCCAAGAGGCAGGG + Intronic
949910655 3:8903972-8903994 GCTCAAAGGCAGTGAATGGCTGG - Intronic
950737845 3:15025044-15025066 GCCCAAAGACAGAAGGTGCAAGG - Intronic
951791245 3:26487163-26487185 GCTCAATGTCAGAAAACCCAGGG + Intergenic
952234398 3:31463941-31463963 GCTGAAAGGTAGAAAGTGGAAGG - Intergenic
952364467 3:32662813-32662835 GCTCAATTGCAGGAAATGCTGGG - Intergenic
954583687 3:51717403-51717425 GCTGAAGGGGAGAACATGCAGGG - Intronic
956118933 3:65946368-65946390 GATGAAATGCAGAAAAGGCAGGG - Intronic
956179543 3:66504327-66504349 GCTCCAAGACAGAAAATGACTGG - Intergenic
956353062 3:68359571-68359593 TCTAAAAGCCAGAAAATTCAAGG + Intronic
957149415 3:76465932-76465954 GATCAAAAGGAGAAAATGTATGG - Intronic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
958639584 3:96788201-96788223 GATCAGAAGCAGAAAATTCAGGG - Intergenic
959320415 3:104866904-104866926 GCTCAAAGGCAAATAAGGTATGG + Intergenic
959884903 3:111488202-111488224 ACTCAAAGGCAGAGAATCCCTGG - Intronic
961407725 3:126693767-126693789 TCCCTAAGGCAGAAGATGCATGG + Intergenic
961470748 3:127110009-127110031 GCTCAGAGGCAGGAAAAACACGG + Intergenic
962051199 3:131817429-131817451 GCTCAAATGCAGTAAATGAGGGG + Intronic
962272046 3:133984454-133984476 GCTGCAAGGTAGAAAAGGCAGGG + Intronic
962917963 3:139923747-139923769 ACTAAAAGCCAGAAAAGGCAAGG + Intergenic
963157840 3:142118094-142118116 TCTCAAAAGAAGAAAAGGCAAGG + Intronic
963341030 3:144033961-144033983 GCCCAAACACAGCAAATGCAGGG - Intronic
964718232 3:159745205-159745227 GATCAAAGGAACCAAATGCAGGG - Intronic
965205005 3:165711291-165711313 GCTCTTTGGCTGAAAATGCATGG - Intergenic
965951816 3:174318156-174318178 GCCCATAGGCTGAAAATGAAGGG + Intergenic
966625257 3:182008908-182008930 GCTGAAAGTCAGAAAATCTATGG - Intergenic
966678697 3:182617589-182617611 GCTCACAGCCTGAAAATGCAAGG + Intergenic
966680477 3:182637179-182637201 GCTCAGAGGCAGAAAAATGAAGG + Intergenic
967032205 3:185618426-185618448 CCTCAAAGAGAGAACATGCAGGG - Intronic
968137743 3:196231189-196231211 GCTCAAAGGCACATAAGGAACGG + Intronic
970471754 4:16386166-16386188 GGAAAAAGGCAGAAATTGCAAGG - Intergenic
970501909 4:16686427-16686449 GCCCAAAGACAAAACATGCAAGG + Intronic
970881264 4:20934958-20934980 GCTTAAAGTCAGGAAATGCCTGG - Intronic
977424091 4:96843922-96843944 TGTCAAGGGCAGCAAATGCAGGG - Intergenic
978588250 4:110295650-110295672 GCTCAGAGGCTGGAAATGCAGGG + Intergenic
978910916 4:114063024-114063046 GATCAAAGGCAAAAAATGATAGG + Intergenic
980507373 4:133740019-133740041 GCTGAAAGACAGAAGATGAATGG - Intergenic
981578038 4:146225486-146225508 GGGCAAAGGCAGAGAATGGAGGG - Intronic
981627426 4:146775107-146775129 GCTCAAAGTAAGTAAATGGATGG - Intronic
982165779 4:152612459-152612481 GTTCAAAGACAGAAAGTCCAGGG - Intergenic
982709056 4:158741779-158741801 GCCCACACCCAGAAAATGCATGG - Intergenic
983030286 4:162792585-162792607 GCTCAAAGGAAAAAAATATAAGG - Intergenic
983499524 4:168483218-168483240 TCACAAAGGGAGAAAATGGAAGG - Intronic
984035427 4:174661793-174661815 CCTCAAAGGTAGAAAAGGGAAGG + Intronic
984899635 4:184573643-184573665 ACCCAGAGGCAGAAATTGCAGGG + Intergenic
985108033 4:186518071-186518093 GCTCAAAAGCATGAAATACATGG - Intronic
985842710 5:2320726-2320748 GCTCAAGAGCAGAAGCTGCAGGG - Intergenic
986854298 5:11851153-11851175 GCTGACAGGCAGGAAATTCAAGG - Intronic
988523643 5:31967742-31967764 GCTGAAAAACAGAAAATCCAGGG - Intronic
990337139 5:54786033-54786055 GCTCAGTGCCAGGAAATGCAAGG + Intergenic
990358369 5:54993883-54993905 GCTAAAAACAAGAAAATGCAGGG + Intronic
990611282 5:57459266-57459288 TCTAGAAGGCAGAAAAGGCAAGG + Intergenic
995490277 5:112683917-112683939 GCTCAAAGGAAGAAAGCTCAGGG - Intergenic
997568685 5:134908872-134908894 GCTTAATGGCAGAGAATCCAGGG + Intronic
997629700 5:135357424-135357446 GATCAAAGGGAGAAAACCCATGG + Intronic
998808843 5:145945573-145945595 GGTCAAGGGAAGAAAAGGCAGGG + Intronic
1000051028 5:157563091-157563113 GACCAAAGGAAGACAATGCAAGG + Intronic
1001208540 5:169788136-169788158 GTTCAAAGGCAGAAAAATCATGG - Intronic
1001260249 5:170222305-170222327 GCACAAAGCCAGCAAATGCCAGG - Intergenic
1001270368 5:170306730-170306752 GCTCAAAGGCTGATAAGGCCAGG + Intergenic
1002876293 6:1213527-1213549 GCTCAAGGGGAGAAAAAGCTGGG + Intergenic
1003455857 6:6281684-6281706 GCTCAAAGATAAAAAATGTATGG + Intronic
1005248616 6:23917920-23917942 AATCCAAGGCAGAAACTGCAGGG - Intergenic
1007500347 6:42292300-42292322 GCTCAGGGGCAGAAATTGCCAGG + Intronic
1008374317 6:50773889-50773911 GCACAAAAGCAGAAAAAGGAAGG - Intergenic
1009424056 6:63494988-63495010 CCTCAAAGGCATAAAATGCATGG - Intergenic
1010301995 6:74271876-74271898 GCACAAAGACAGAAAACTCAAGG - Intergenic
1010805208 6:80227858-80227880 GCTCACAGGAATAAAAAGCAAGG - Intronic
1011665555 6:89629583-89629605 GGTAAAAGGCACAAAAGGCAAGG - Intronic
1012010242 6:93774699-93774721 CCCTAAAGGCAGAAAAAGCAGGG + Intergenic
1012033726 6:94104836-94104858 GCTTGAAGGCAGAAAATGACAGG + Intergenic
1012756068 6:103232051-103232073 GCTTAAAATCAGAAAATGAATGG + Intergenic
1014007156 6:116432777-116432799 GTTAAACGACAGAAAATGCAAGG - Intronic
1014518835 6:122413344-122413366 GCTCAATGGGAGAGAACGCAAGG - Intronic
1014600851 6:123410334-123410356 GCAAAAGGGGAGAAAATGCATGG - Intronic
1014906949 6:127041887-127041909 ACTCAAAGCTAGAAAATCCATGG + Intergenic
1015059185 6:128941890-128941912 GTTCAGAGGTAGAAGATGCAGGG + Intronic
1015584176 6:134758716-134758738 ACCCACAGGCAGAAACTGCATGG + Intergenic
1016637916 6:146316163-146316185 TCTAAAAGCCAGAAAAAGCAAGG - Intronic
1019132055 6:169884221-169884243 TCTCAGAGGCTGAAGATGCATGG + Intergenic
1020364436 7:7365468-7365490 GCTCAAAGGCTGAAAGAGAATGG - Intronic
1021149528 7:17132507-17132529 GCTGAAAGCTGGAAAATGCAAGG + Intergenic
1021167823 7:17362066-17362088 CCTAAAAGGTAGAAAAGGCAAGG + Intergenic
1021362327 7:19731149-19731171 ACTCAAAGGCAAAAAATGTTGGG + Intronic
1021514344 7:21466465-21466487 CCTCAAAGGAAGAAACTGCAGGG + Intronic
1021922170 7:25496514-25496536 GATCAGAGGGAGGAAATGCAGGG - Intergenic
1022257300 7:28671983-28672005 GCTCACAGGCATTAAGTGCATGG - Intronic
1022335855 7:29421329-29421351 GCCCAAAGGCAGGAAATGGGGGG - Intronic
1022941018 7:35239624-35239646 GCACAAAAGAAGAAAATGTATGG + Intronic
1023724750 7:43131406-43131428 AGTGAAAGGCTGAAAATGCAGGG - Intronic
1024263628 7:47589989-47590011 GCAGAAAGGAAGAAAAGGCAGGG - Intergenic
1026475144 7:70728749-70728771 GGTCAAAGGCACAACTTGCACGG - Intronic
1027231364 7:76274554-76274576 GCTCAAATTCAGAAGATGGAAGG - Intronic
1027264575 7:76487327-76487349 GCTCAAAAGAAGAAGAGGCAGGG - Intronic
1027315945 7:76985429-76985451 GCTCAAAAGAAGAAGAGGCAGGG - Intergenic
1029615062 7:101651102-101651124 GGTCAAAGGCAGAACATGGTGGG + Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030827438 7:114176828-114176850 ACTAAAAGGCAGATAAAGCATGG - Intronic
1032973958 7:137200543-137200565 CCTCGAAGCCAGAAAAGGCAAGG + Intergenic
1033431624 7:141294837-141294859 GCTGAAAGGCGGAAAAGGCAGGG - Intronic
1033444441 7:141408065-141408087 TCTCAGTGTCAGAAAATGCAGGG - Intronic
1034092661 7:148378393-148378415 GCTCTAAGGCAGAACATCCAGGG + Intronic
1034871583 7:154689897-154689919 GGTCAAATAAAGAAAATGCATGG - Intronic
1035653272 8:1284962-1284984 GCTCAAAGCCAGCAAATGCCAGG + Intergenic
1036024597 8:4890927-4890949 ACGCAAAGGCAGAGAATCCAAGG + Intronic
1036846697 8:12175133-12175155 GCTCAAGTGCAAAAACTGCAGGG - Intergenic
1037086362 8:14855745-14855767 GCTCAAAGGCAGAACATGCCCGG + Intronic
1037684504 8:21127198-21127220 GCTCAAAGGGAGATTAAGCAGGG + Intergenic
1038184408 8:25259926-25259948 GTTCAAAGGCAGAAAGTCAAGGG - Intronic
1038330208 8:26602232-26602254 TCCCAAAGGCAGCAAAGGCATGG - Intronic
1039613486 8:38937158-38937180 GTACAAAGGCACAAGATGCAGGG + Intronic
1040892470 8:52331518-52331540 ACGAAAAGGGAGAAAATGCAGGG + Intronic
1041795685 8:61745314-61745336 GCTCTAAAACAGAAAATGCCTGG - Intergenic
1041994578 8:64038486-64038508 CCTCAATGGTAGAAAAAGCAAGG - Intergenic
1042439681 8:68811002-68811024 GCTCCAGGGCAGAAAGTGCTGGG - Intronic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1044051982 8:87516394-87516416 GGTCAAAGAGAGAAAAAGCAGGG + Intronic
1046026953 8:108736036-108736058 GTTTAAAAGCAGAAAATGCTTGG - Intronic
1048220612 8:132537765-132537787 TCTCAAATTAAGAAAATGCAAGG - Intergenic
1048222096 8:132551509-132551531 GTCCAAAGGCAGAAAATATAGGG - Intergenic
1048230801 8:132639197-132639219 GCTCATAGAAAGAAACTGCAAGG - Intronic
1048544648 8:135375504-135375526 GAAGAAAAGCAGAAAATGCAGGG + Intergenic
1051326243 9:15972764-15972786 GCTACAAGGCAGAAAATGCAGGG - Exonic
1052315663 9:27114046-27114068 GCTCAAAGACACAATCTGCATGG - Intronic
1052742427 9:32405998-32406020 GTGCAAAGGCAGAAAAAGGACGG - Intronic
1052987095 9:34495713-34495735 GCCCATAGGTAGAAGATGCAGGG + Intronic
1053314944 9:37043141-37043163 GCTCGGAGGGAGAAAATGCTTGG + Intergenic
1053354995 9:37437928-37437950 GCTCAAAGACAGAAAAGGCGGGG + Intergenic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1056840423 9:89994409-89994431 GCTAAGAGACAGAAACTGCAAGG + Intergenic
1057113079 9:92492769-92492791 CCTCAGAGTCAGAAGATGCAGGG + Intronic
1057309272 9:93931639-93931661 GCACACAGGCAGAAAAGTCACGG + Intergenic
1057422291 9:94922076-94922098 GCTCAAGGGGAAAAAATGAAAGG + Intronic
1058914651 9:109554113-109554135 ACTCAAAGGCAGAAACGTCAGGG - Intergenic
1059088282 9:111328426-111328448 GATGAAAGAAAGAAAATGCAAGG - Exonic
1061969535 9:134036451-134036473 GCCCCAAGGCAGAAAATCCAAGG + Intronic
1062038817 9:134394923-134394945 GCACAAATGCAGAGAAAGCAGGG - Intronic
1062404743 9:136390248-136390270 GTTAAAAGGCTGAAAATACAGGG + Intronic
1187240619 X:17509710-17509732 GCTTAAAGGTAGACAATCCAGGG + Intronic
1187621276 X:21058719-21058741 GCACATTGGCTGAAAATGCAGGG - Intergenic
1188102581 X:26108286-26108308 GTTCAAAGGATGAAAATGGAAGG + Intergenic
1188487630 X:30700700-30700722 GGCCAAATGGAGAAAATGCAAGG + Intronic
1188499114 X:30806520-30806542 GCACAAAGGAAGGCAATGCAAGG - Intergenic
1188602746 X:31989025-31989047 GCTCAAAGGCAGGAAAAGATGGG + Intronic
1188654890 X:32680990-32681012 GGTCAAAGGTAGAAAATGTATGG - Intronic
1189243193 X:39541431-39541453 CCTCAAGGGCAGAAAATGCCTGG - Intergenic
1189528978 X:41858469-41858491 GCTGAAGAGCAGGAAATGCAGGG + Intronic
1189555842 X:42144448-42144470 GCTCAGAGGCAGAACATACTGGG - Intergenic
1190014177 X:46812618-46812640 GCTGAAAGGCAGGAAATGTTTGG - Intergenic
1192495491 X:71614275-71614297 TCTAAAAGGCAGAAAAGGCCGGG - Intergenic
1193067796 X:77277739-77277761 ATTCAAATTCAGAAAATGCATGG + Intergenic
1193526600 X:82598337-82598359 GCTCAAAGGCAAAAGATTCCTGG - Intergenic
1195434333 X:104825244-104825266 GCTCAAAGGCAAATAAGGTATGG + Intronic
1195672763 X:107483580-107483602 GCACAAGGGCAGAAAATCCAGGG - Intergenic
1198027384 X:132720402-132720424 GCTTAAAGGCAGAGTATGAAGGG - Intronic
1198154405 X:133944803-133944825 GCCCATAGGAATAAAATGCATGG - Intronic
1198171012 X:134105239-134105261 TCTCAAAAGGAGAAAAGGCAAGG + Intergenic
1198862982 X:141090434-141090456 GCTGGAAGGAAAAAAATGCATGG + Intergenic
1198899710 X:141496953-141496975 GCTGGAAGGAAAAAAATGCATGG - Intergenic
1199186517 X:144921694-144921716 GCCAAATGGCAGAAATTGCAAGG + Intergenic
1199200209 X:145078450-145078472 GCTCAAAGTCAGACAGTGAATGG - Intergenic
1199753750 X:150845600-150845622 CCCCAAAGCCAGAAGATGCAAGG + Intronic
1199989716 X:152979542-152979564 GCTCAAGGCCAGAGAATGCCTGG - Intergenic
1200354403 X:155533176-155533198 GTTCAAAGGCCTAAAATGGAAGG - Intronic
1200366220 X:155667500-155667522 GCACAGAGGCAGAAAGTGTAGGG + Intronic
1200773879 Y:7152355-7152377 CCACAAAGACAGAAAATACATGG + Intergenic
1202364874 Y:24152434-24152456 GCTCTGCAGCAGAAAATGCATGG - Intergenic
1202505907 Y:25517688-25517710 GCTCTGCAGCAGAAAATGCATGG + Intergenic