ID: 918584847

View in Genome Browser
Species Human (GRCh38)
Location 1:186174422-186174444
Sequence GCATTCTGTAGAATTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918584847_918584849 2 Left 918584847 1:186174422-186174444 CCTTTGGCAATTCTACAGAATGC 0: 1
1: 0
2: 0
3: 16
4: 171
Right 918584849 1:186174447-186174469 ACTTTAAATACAATGACTTTGGG 0: 1
1: 0
2: 1
3: 33
4: 472
918584847_918584850 13 Left 918584847 1:186174422-186174444 CCTTTGGCAATTCTACAGAATGC 0: 1
1: 0
2: 0
3: 16
4: 171
Right 918584850 1:186174458-186174480 AATGACTTTGGGTTTGAAAGAGG 0: 1
1: 0
2: 4
3: 17
4: 243
918584847_918584848 1 Left 918584847 1:186174422-186174444 CCTTTGGCAATTCTACAGAATGC 0: 1
1: 0
2: 0
3: 16
4: 171
Right 918584848 1:186174446-186174468 GACTTTAAATACAATGACTTTGG 0: 1
1: 0
2: 1
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918584847 Original CRISPR GCATTCTGTAGAATTGCCAA AGG (reversed) Intronic
904060420 1:27705511-27705533 GCTTTCAGTAAAATTGCAAAAGG - Intergenic
905677190 1:39834935-39834957 GCGTTCTTTACAATAGCCAAGGG - Intergenic
905755989 1:40509291-40509313 GCCTTCTGCAGAATTGCCGATGG - Exonic
907989709 1:59567854-59567876 GCATTCAGGAGACTTGACAAAGG - Intronic
910019670 1:82571288-82571310 GCAATCTATAGAATTGCATAGGG - Intergenic
910403930 1:86865838-86865860 GCATTATTTACAATAGCCAAGGG + Intronic
911928836 1:103873929-103873951 ACACTCTGTAGAATCGACAAAGG + Intergenic
913833216 1:123284061-123284083 TCATTCTGTCGAATTTCCATAGG - Intergenic
918584847 1:186174422-186174444 GCATTCTGTAGAATTGCCAAAGG - Intronic
1064365653 10:14705426-14705448 GCATTGTCTACAATAGCCAAAGG + Intronic
1065152873 10:22840197-22840219 GCATTGTCTAGAAAAGCCAAGGG + Intergenic
1065300996 10:24321226-24321248 GCATTATTCACAATTGCCAAGGG + Intronic
1065635938 10:27734294-27734316 GTTTTGTTTAGAATTGCCAATGG - Intronic
1066408686 10:35144535-35144557 AAATTCTGTAGTATTGACAAAGG + Intronic
1066812498 10:39358155-39358177 TCTTTCTGTAGAATCTCCAAAGG - Intergenic
1066814803 10:39392933-39392955 TCCTTTTGTAGAATTGCCAAAGG + Intergenic
1066815204 10:39399271-39399293 GCTTTCTGTAGAATCTGCAAAGG + Intergenic
1066929329 10:41737010-41737032 TCATTCTGGAGAATTTGCAAAGG + Intergenic
1068149108 10:53110286-53110308 TCATTCTGTACAAATGCAAAAGG - Intergenic
1068738223 10:60438899-60438921 TCATTCTGTGAAATGGCCAAAGG - Intronic
1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG + Intergenic
1070568882 10:77625775-77625797 GCATTATTTACAATGGCCAAAGG - Intronic
1074954571 10:118375925-118375947 GCATACTGTAGAATTGCATTTGG + Intergenic
1078233506 11:9463209-9463231 GCATTATGTGTAATAGCCAAAGG - Intronic
1080030228 11:27652560-27652582 GCACTCTGTAGGATTTCCATAGG - Intergenic
1082601020 11:55154369-55154391 TCTTTTTGTAGAATTTCCAAAGG - Intergenic
1082601716 11:55166615-55166637 TCATTTTGTAGAATCGGCAAAGG - Intergenic
1082755886 11:57076024-57076046 GCATCATGTAGAACTGCTAATGG - Intergenic
1085362912 11:75908347-75908369 GCATTATTTACAATAGCCAAGGG - Intronic
1086558663 11:88141830-88141852 AAAATCTGTAGAATTTCCAAAGG - Intronic
1088295781 11:108292349-108292371 GAATTCTGTAAAATAGTCAAAGG - Intronic
1090205371 11:124880749-124880771 GAATCCTGTAGAAGTGACAAGGG + Intronic
1091438936 12:497541-497563 GCATTATTCACAATTGCCAAAGG - Intronic
1091639009 12:2220138-2220160 GCTTTCTGTACAATTGCCCAGGG - Intronic
1091674978 12:2482570-2482592 GCGTTCTGAAGACTTGCCATGGG - Intronic
1093109408 12:15131438-15131460 GCATTTTGTTAAGTTGCCAAGGG + Intronic
1094408564 12:30145960-30145982 ACATTCTGTGGAATTGCAATAGG + Intergenic
1094874285 12:34623363-34623385 GAATTCTGTATAATTCCCAAGGG - Intergenic
1095773828 12:45990945-45990967 GCAGCCTGTAAAACTGCCAAAGG - Intronic
1098779998 12:74675134-74675156 GCATTCTTTACAAATTCCAAAGG + Intergenic
1099281907 12:80660370-80660392 CCATTCTCGAGAATGGCCAACGG - Intronic
1099886659 12:88539301-88539323 GCATTTTGTAAAAGTGTCAAGGG - Intronic
1105077256 13:16047928-16047950 TCATTTTGTAGAATAGGCAAAGG + Intergenic
1105983558 13:25543937-25543959 GATTTCTGTAGAATTTCAAAAGG - Intronic
1107036154 13:35904806-35904828 GCAATCTGCAAAATTGCAAAGGG + Intronic
1107191880 13:37598081-37598103 GAATTCTGTAAAATTTGCAAAGG - Intronic
1107376371 13:39809103-39809125 GCATTCTGGAGAAATCCCCAGGG + Intergenic
1109211596 13:59541459-59541481 CCATTGTGTACAATTGCCTACGG - Intergenic
1109914609 13:68964869-68964891 GAATTGTGAAGAATTGCTAATGG - Intergenic
1110128337 13:71976488-71976510 GTATTGTGTAGAATTGTAAATGG + Intergenic
1110695290 13:78480909-78480931 GCATTCACTAAAGTTGCCAATGG + Intergenic
1113998874 14:16125410-16125432 GTATTTTGTAGAATTTCCAAAGG - Intergenic
1115471058 14:33769173-33769195 AAATTCAATAGAATTGCCAAAGG - Intronic
1115500058 14:34041748-34041770 GCATTCTCTGTTATTGCCAATGG - Intronic
1115771736 14:36669588-36669610 GACATCTGTAGAATTACCAAAGG + Intronic
1115844692 14:37515046-37515068 TCATTCTGTAAATTTACCAATGG - Intronic
1116469406 14:45269662-45269684 GCATCCTGCAAAATTGCCAGAGG + Intergenic
1117217159 14:53562646-53562668 GAATTCTATACCATTGCCAAGGG + Intergenic
1117301049 14:54428421-54428443 GCACTCTGTAGAATTGCCCTTGG - Intronic
1119118351 14:72048448-72048470 TCTTTCTGTTGAATTGCAAAGGG - Intronic
1120817408 14:88877185-88877207 GCATGCTGTAGAAATTCAAAGGG - Intronic
1122227949 14:100290653-100290675 GCATCCTGGAGCTTTGCCAAAGG - Intergenic
1123227841 15:17063688-17063710 GTATTTGGTAGAATTTCCAAAGG + Intergenic
1126819713 15:52490301-52490323 GCATTCTTCACAATAGCCAAAGG + Intronic
1127779258 15:62297020-62297042 GCATTCCTTAGAAATGCCAGTGG - Intergenic
1136915255 16:34185297-34185319 GTATTTTGCAGAATTTCCAAAGG - Intergenic
1138213819 16:55185528-55185550 GCATTCTTCACAATAGCCAAAGG + Intergenic
1140061019 16:71569776-71569798 TCATTCAGCAGAATTGCCACAGG - Intronic
1140238084 16:73176673-73176695 GCATTCTGGAGAATGGTAAAGGG - Intergenic
1141404184 16:83777256-83777278 GCACTCTGTAGAATTGGTACAGG + Intronic
1143315710 17:6031868-6031890 GCATTTTCTAGAATAGCGAATGG - Intronic
1144395641 17:14840217-14840239 GCATTCTTGAAAATTGCTAAGGG + Intergenic
1145417590 17:22733818-22733840 GTCTTTTGTAGAATTGGCAAAGG + Intergenic
1146422045 17:32696106-32696128 GCATTTTGTAGAATTTTCTAAGG + Intronic
1147674840 17:42197976-42197998 GCATTATGCATAATAGCCAAAGG - Intergenic
1149391335 17:56194327-56194349 GCTTTATTTATAATTGCCAAAGG + Intronic
1150361633 17:64540160-64540182 GCAGTCTGTGGGATTGGCAAGGG - Intronic
1152138159 17:78518696-78518718 GCATTCTGTTCAAGTGCCCATGG + Intronic
1158015068 18:52774575-52774597 GCATTCTGTTGAAATGGCAAAGG + Intronic
1159184890 18:64956904-64956926 TAATTCTGTGGAATTGGCAATGG + Intergenic
1164353993 19:27393878-27393900 GTTTTCTGTAGAATCGTCAAAGG - Intergenic
1164362360 19:27528208-27528230 TCATTTTGTAGAATTGGCAATGG + Intergenic
1164363588 19:27547385-27547407 TCATTTTGTAGAATTGGCAATGG + Intergenic
926916298 2:17895376-17895398 ACATGTTGTAGAATTTCCAAAGG - Intronic
928905697 2:36365182-36365204 ACATTCTGCTGAAATGCCAAAGG - Intronic
934691054 2:96359539-96359561 GCATTCTGTAGAACTCCAAAGGG + Intronic
935987402 2:108688368-108688390 GCATTCTGTAATTTTACCAAAGG + Intergenic
937892924 2:126953439-126953461 GCATTCTGTGTAATTGCACATGG - Intergenic
938891442 2:135709598-135709620 GCTTTTTGTAGAAATGCCTAAGG - Intronic
939172310 2:138710336-138710358 GCATTATTCACAATTGCCAAAGG - Intronic
940514123 2:154658432-154658454 GTATTCTTTAGAAATGCAAAGGG - Intergenic
941103657 2:161326617-161326639 GCATTATTTATAATAGCCAAGGG + Intronic
945489396 2:210437366-210437388 GCATTATTTATAATTGCCACAGG - Intronic
946874417 2:224113672-224113694 GCATTTTGTTGAATGGTCAAAGG - Intergenic
1170436985 20:16340506-16340528 GCATTCTGAAGAGTTGGAAAGGG + Intronic
1171734486 20:28758712-28758734 GTATTTTGTAGAATTTCCAAAGG - Intergenic
1171742754 20:28920835-28920857 GTATTTGGTAGAATTTCCAAAGG - Intergenic
1173079774 20:39854605-39854627 TCAGACTGTAGAATTACCAAGGG - Intergenic
1173211103 20:41032492-41032514 GCTATCTGTAGAATTGATAATGG + Intronic
1175194542 20:57233763-57233785 CCACTCTGTAGACTTGCAAAGGG + Intronic
1176324633 21:5380350-5380372 GTATTTGGTAGAATTTCCAAAGG + Intergenic
1176482189 21:7310766-7310788 GTATTTGGTAGAATTTCCAAAGG + Intergenic
1176531963 21:7974788-7974810 TCATTTTGTAGAATTTACAAAGG - Intergenic
1176761378 21:10797153-10797175 GTATTTGGTAGAATTTCCAAAGG + Intergenic
1176970927 21:15264793-15264815 ACATTCTGTAGAATTATAAAAGG + Intergenic
1177795130 21:25768150-25768172 GCATTCTATAGAGATGCAAATGG - Intronic
1179361880 21:40717396-40717418 GCATTATGTATAATGGCCAATGG + Intronic
1180401075 22:12425988-12426010 GTATTTGGTAGAATTTCCAAAGG + Intergenic
1182341177 22:29622214-29622236 GCATTTTGTAAACTTGCCAGTGG + Intronic
1184206001 22:43003692-43003714 GCACTTTGTAAAATTGCGAAAGG - Intronic
952490508 3:33867398-33867420 ACATTATGAAGTATTGCCAATGG - Exonic
953220890 3:40970689-40970711 GCATTCTGCACACTTGCCAAAGG - Intergenic
953683647 3:45059455-45059477 GCATAATTTAAAATTGCCAAAGG - Intergenic
955255016 3:57322458-57322480 CCATTCTGTAGAATTGTTACTGG + Intronic
958217752 3:90612857-90612879 TCTTTTTGTAGAATTTCCAATGG - Intergenic
958218230 3:90622183-90622205 TCTTTTTGTAGAATTTCCAAGGG - Intergenic
958221000 3:90678844-90678866 TCTTTTTGTAGAATTTCCAAGGG - Intergenic
958223739 3:90782906-90782928 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
958225106 3:90805841-90805863 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
958240900 3:91071736-91071758 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
958246099 3:91158742-91158764 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
958248159 3:91193233-91193255 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
958249892 3:91222115-91222137 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
958251445 3:91247762-91247784 TCTTTTTGTAGAATTTCCAAGGG - Intergenic
958251546 3:91249461-91249483 TCTTTTTGTAGAATTTCCAAGGG - Intergenic
958272503 3:91521434-91521456 TCTTTTTGTAGAATTTCCAATGG - Intergenic
958403320 3:93717766-93717788 TCTTTTTGTAGAATTTCCAAGGG - Intergenic
958732111 3:97971212-97971234 ACATTCTGTAAAACTGCCCAGGG - Intronic
960933407 3:122878183-122878205 GCATTTTGTAGAAGTACAAAGGG + Intronic
962918636 3:139931903-139931925 GGATTCTGTAGAGGTGGCAAAGG + Intergenic
965497127 3:169412465-169412487 GCATACGCAAGAATTGCCAAAGG - Intronic
970771481 4:19618013-19618035 GCATGCTCCTGAATTGCCAATGG + Intergenic
975530958 4:75398970-75398992 GCATTATTTACAATAGCCAAAGG + Intergenic
981150041 4:141369782-141369804 GCTTTTTGTAGAATCACCAAAGG + Intergenic
983320875 4:166195001-166195023 GCATTATTCAGAATAGCCAAAGG - Intergenic
984557768 4:181235506-181235528 GCCTTCCGTAGAATCGCTAACGG - Intergenic
993560915 5:89407231-89407253 GCCTTCTGAAGAATTTCCCAAGG - Intergenic
994359534 5:98834565-98834587 GCTTTCTATATCATTGCCAATGG - Intergenic
995037717 5:107553694-107553716 GAATTCTGTAGAATTCCCATTGG - Intronic
996395309 5:123007589-123007611 GCATTCTGTAGAATGGAACAAGG - Intronic
996721205 5:126631908-126631930 GCTTTCTGTATAGATGCCAAAGG - Intronic
1003866573 6:10368756-10368778 TCATTCTGCAGCACTGCCAAGGG + Intergenic
1009110156 6:59178421-59178443 TCATTTTGTAGAATTTGCAAGGG + Intergenic
1009255869 6:61397157-61397179 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
1010464859 6:76155410-76155432 GCTTTTTGTAGAATTTCCTAAGG - Intergenic
1012478768 6:99644283-99644305 GTATTCTTGAGAATTGCTAAGGG + Intergenic
1014113019 6:117641719-117641741 GCATTCTTCACAATAGCCAAAGG - Intergenic
1014842382 6:126235726-126235748 GCATTATGAAGAATAGCTAATGG + Intergenic
1015797147 6:137024592-137024614 GCATTTGGCAGAATTGCAAAAGG - Intronic
1015955558 6:138594577-138594599 GTATTTTGTAGATTTGGCAATGG - Intronic
1025568198 7:62516881-62516903 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
1025568299 7:62518577-62518599 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
1025568475 7:62521978-62522000 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
1025568565 7:62523680-62523702 TCTTTTTGTAGAATTTCCAAGGG + Intergenic
1027806461 7:82831507-82831529 GCCTTCTTTAGAGTTGCCTAGGG + Intronic
1029016395 7:97319199-97319221 GCTTTCTGTAGAATATCAAATGG - Intergenic
1029194329 7:98794186-98794208 GCATTATTTACAATAGCCAAAGG + Intergenic
1033530660 7:142259990-142260012 GCAATCTGTATAGCTGCCAAAGG - Intergenic
1035136251 7:156705811-156705833 GAATTCTGTAGTATTGCCATTGG - Intronic
1037186810 8:16074479-16074501 ACATTCTGAAGAGCTGCCAAGGG - Intergenic
1038153337 8:24962291-24962313 GGATTCTGTACAAGTGCCATGGG + Intergenic
1040283092 8:46078627-46078649 ACTTTCTGTAGAATTTGCAAAGG + Intergenic
1043671240 8:82887583-82887605 GCATTATTTACAATAGCCAAAGG + Intergenic
1044204038 8:89470999-89471021 GCATTCTGCAGAATTGGCTAAGG - Intergenic
1044866947 8:96580780-96580802 GCCTTCTGTAAAGTAGCCAATGG - Intronic
1046044670 8:108949530-108949552 GTATGCTGAAAAATTGCCAAGGG - Intergenic
1046859580 8:119075605-119075627 TCATTCTTTAGAATTTACAAAGG + Intronic
1047013003 8:120692577-120692599 GCATTCCTTATAATTGCCATGGG + Intronic
1047997188 8:130348042-130348064 ACATTCTGTAGAACTGGAAAAGG - Intronic
1048537303 8:135309231-135309253 TAATTCTGCAGAATTGCCAGAGG - Intergenic
1050571475 9:6943755-6943777 GCATTGTGTAGAAGTGGGAATGG + Intronic
1051253393 9:15185988-15186010 GAATTCTGTAGAATTTTAAAAGG - Intronic
1051381341 9:16462088-16462110 GCAATCCATAGACTTGCCAATGG - Intronic
1052367601 9:27630634-27630656 GCATTCTCTAGGATAGACAAAGG + Intergenic
1054716061 9:68558912-68558934 GCATCCTATAGAAATGACAAAGG + Intergenic
1055669807 9:78592741-78592763 GAATTCTGTAGCATTTCAAAGGG + Intergenic
1056628797 9:88275812-88275834 GCATTCACTAGATTTGCCACAGG - Intergenic
1059355956 9:113699595-113699617 GCTATCTGGAGAATGGCCAAGGG + Intergenic
1203382428 Un_KI270435v1:68652-68674 GTATTTGGTAGAATTTCCAAAGG + Intergenic
1186042187 X:5492721-5492743 TCATTCTGTAGAAAAACCAAAGG - Intergenic
1186879890 X:13854294-13854316 CCATTCTGTAGAACTACAAAGGG + Intronic
1191574054 X:62675068-62675090 ACATTTTGTAGAATTTGCAAAGG + Intergenic
1191578387 X:62732728-62732750 TCTTTTTGTAGAATTGGCAAAGG - Intergenic
1191812100 X:65200350-65200372 GCAATCTGTATATTTGACAAAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194936506 X:99956182-99956204 CCATCATGTAGAATTGACAAAGG + Intergenic
1196017027 X:110950327-110950349 GCATTCTGTAGAACAGCACATGG - Intronic