ID: 918586167

View in Genome Browser
Species Human (GRCh38)
Location 1:186191341-186191363
Sequence CTTGCCTGACAGCTGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918586167 Original CRISPR CTTGCCTGACAGCTGGACTA TGG (reversed) Intergenic
901952903 1:12762699-12762721 CCTCCCTGACTGCTGGACTGAGG - Exonic
902602065 1:17546805-17546827 CTTTCCTGACACCAGGCCTAGGG - Intronic
906353460 1:45082983-45083005 GTACCCTGACAGCTGGGCTATGG - Intronic
906519533 1:46458941-46458963 CTTGCCAGACAACTGGAGGAAGG - Intergenic
907401790 1:54228967-54228989 CCTGCCTGGCAGCTGGGCCAGGG + Intronic
912463946 1:109856470-109856492 CTTGCGTGCCAGAAGGACTAAGG - Intergenic
912724689 1:112048465-112048487 CCTGCCTGACAGCTTGAGTTGGG + Intergenic
913322988 1:117602765-117602787 CTTGACTTACAGTAGGACTATGG + Intergenic
913550077 1:119908650-119908672 ATTGCATGACAGCGGGACAAGGG + Intergenic
918586167 1:186191341-186191363 CTTGCCTGACAGCTGGACTATGG - Intergenic
922397918 1:225222047-225222069 GTTGCCTGACAGCGTGGCTAGGG - Intronic
924685990 1:246290373-246290395 CTTCCCTGATAGCTTTACTAGGG - Intronic
1064114438 10:12566220-12566242 CTTGCTAGACAGCGGGAATAGGG + Intronic
1067833790 10:49625496-49625518 CTGCCCTGACAGCTGGCCTTTGG - Exonic
1069251128 10:66268493-66268515 CATGTCTGACATCTGGACTAAGG - Intronic
1069779472 10:70945756-70945778 CTGGCCTGACAGCTGGGAGATGG + Intergenic
1069907675 10:71741336-71741358 CTGGCCTGAGAGCTAGACTCTGG - Intronic
1070307457 10:75248180-75248202 CTTGCCTGCCAGTGGGCCTACGG - Intergenic
1071267417 10:83976461-83976483 CTTGCCTGACAACTGCCCCAGGG + Intergenic
1073861496 10:107747740-107747762 TTTGGTTGACAACTGGACTAAGG + Intergenic
1078463608 11:11533900-11533922 CCTGCCTGGCAGATGGAGTAGGG + Intronic
1078861875 11:15256069-15256091 CATGCATGACAGCTGGAGCATGG + Intergenic
1081017428 11:37900255-37900277 TTTGCCTGACAGCATGTCTAGGG - Intergenic
1083214910 11:61212451-61212473 CGTGCCTTACAGCTGGACCAGGG + Intronic
1083217794 11:61231280-61231302 CGTGCCTTACAGCTGGACCAGGG + Intronic
1083220786 11:61251030-61251052 CGTGCCTTACAGCTGGACCAGGG + Intronic
1084383579 11:68828603-68828625 CCTGGCTGCCAGCTGGCCTAAGG - Intronic
1085641966 11:78198270-78198292 CTGGCCTGACAGCATCACTAGGG - Intronic
1087060622 11:93973507-93973529 TTTGCCTGACAGCGTGACTAGGG - Intergenic
1087154401 11:94886443-94886465 CTAACCTGATGGCTGGACTAGGG + Intergenic
1088503472 11:110507275-110507297 CTTGCCTGACCCCAAGACTAGGG - Intergenic
1088526369 11:110760365-110760387 CATTCCTGACAGCTGGACAGAGG + Intergenic
1088535671 11:110858234-110858256 GTTGTCTATCAGCTGGACTAGGG + Intergenic
1089647786 11:119891613-119891635 CGTGCCAGACAGCTGTACAATGG - Intergenic
1094175173 12:27533957-27533979 CTGACCTGACAGCAGGACCAGGG - Intronic
1095049624 12:37544422-37544444 CTTGCATGTCAGCTGGTCTTTGG + Intergenic
1096220395 12:49825453-49825475 CTTGCCTGACAGCCGAAGTGGGG - Intronic
1100431512 12:94535359-94535381 CCTGCTTGACAGCTGGCCTTGGG + Intergenic
1102761258 12:115387271-115387293 TGTGCTTTACAGCTGGACTAAGG + Intergenic
1103190338 12:118995878-118995900 CTTGACTGACAGGTGGATAAAGG - Intronic
1104948825 12:132429559-132429581 CCTGCCTGACAGCGGGGCTCAGG + Intergenic
1106921406 13:34567885-34567907 CTTGCCTGAGAGCATGGCTAGGG - Intergenic
1106979546 13:35261387-35261409 CATCCCTAGCAGCTGGACTACGG - Intronic
1108060816 13:46531392-46531414 GTTCCCTGGCAGATGGACTATGG - Intergenic
1110168693 13:72474371-72474393 TTTGCCAGCCAGCTGGACAAAGG + Intergenic
1110645419 13:77877729-77877751 CTTGTGTGACAGCTGGACAAGGG + Intergenic
1111653186 13:91118867-91118889 CTTGCCTGAAATCTGAATTAGGG + Intergenic
1113320039 13:109224159-109224181 CTTGCCTGACAGCTGCCTCAGGG + Intergenic
1113522669 13:110951642-110951664 CTTCCGTTACAGCTGGACTTGGG + Intergenic
1113579284 13:111417477-111417499 CTGTCCAGACAGCTGGACTCCGG - Intergenic
1115502394 14:34060913-34060935 CGTGCCTGACAGCTGAATGACGG + Intronic
1119538587 14:75423392-75423414 CTTCCCAAATAGCTGGACTATGG + Intergenic
1121214914 14:92240303-92240325 CTTGCCAGGCACCTGGACCATGG + Intergenic
1126783529 15:52158532-52158554 GTTGCTTGACAGCTGAAGTAGGG - Intronic
1130650540 15:85759912-85759934 CCTCCCTGACACCTGGGCTATGG - Exonic
1130831423 15:87604989-87605011 CTGCCCTGACAGCAGAACTAGGG + Intergenic
1132982013 16:2743101-2743123 CTTGCCAGCCAGCTGGACGCTGG + Intergenic
1135490281 16:22903739-22903761 CTTGTCACACAGCAGGACTAGGG + Intronic
1135731764 16:24900490-24900512 CTTTCCTGGAAGCAGGACTAGGG - Intronic
1136661555 16:31767481-31767503 TTTGCCTGACAGCGCAACTAGGG + Intronic
1137614199 16:49837248-49837270 CCTGCCTGCCAGCTGGACACAGG + Intronic
1138362773 16:56445686-56445708 CCTGCCTGTCTGCTGGACTAAGG + Intronic
1139432545 16:66918827-66918849 CTTGCTTGGCAGCTGGACCAAGG - Exonic
1139507647 16:67407206-67407228 CTAGCCGGACAGCTGGCCCAGGG + Intronic
1142589055 17:993208-993230 CTGGTCTGACAGATGGAATAAGG - Intergenic
1146381097 17:32328113-32328135 CTTTCCTGGCACCTGGTCTAAGG + Intronic
1147938157 17:44025513-44025535 CTTCCCTGAGAGCTGGGCTCTGG - Intergenic
1148430182 17:47636434-47636456 CTGGCCTGGCAGCAGGCCTAGGG - Intergenic
1150654820 17:67032862-67032884 CTTGCTGGACAGCGGGACTGGGG - Exonic
1151351617 17:73535217-73535239 CTTCCTTGAGAGCAGGACTATGG + Intronic
1153954922 18:10087972-10087994 CTGGGCTGACAGGTGGACTGTGG + Intergenic
1159049486 18:63406114-63406136 CTTGCTTTACAACTGGAATAAGG + Intronic
1162938703 19:13995301-13995323 CGTGCCTGCCATCTGGACTTGGG + Intronic
1163595166 19:18217050-18217072 CTTCCCTGACTGCAGGGCTAGGG + Intronic
1166360322 19:42250430-42250452 ATTGCCTGGCAGGGGGACTACGG - Exonic
1167785232 19:51630365-51630387 CTTCCCTGACAGCCGGACCTGGG - Intronic
1167787331 19:51646789-51646811 CTTCCCTGACAGCCGGACCTGGG - Exonic
1168582905 19:57570188-57570210 CTTGCCTGAATTCTGGAATAAGG + Intergenic
926120530 2:10239179-10239201 CTTGCCTGACTCCAGGACTCAGG - Intergenic
927893381 2:26766135-26766157 CCTGCCTGACAGCTGGTGTGGGG + Intronic
928241072 2:29587060-29587082 CTTGCCTGAAAGTTAGCCTAGGG + Intronic
929821825 2:45280499-45280521 TTTGCCAAACAGCTGGACGATGG + Intergenic
934654061 2:96108268-96108290 CTGGCCTGGCAGCTGGATTTGGG - Intergenic
939226922 2:139376541-139376563 CTTGCCTGACACCTGCTCCAGGG - Intergenic
945707198 2:213249974-213249996 CTTCCGTGACTGGTGGACTAGGG + Intergenic
946872669 2:224098500-224098522 CTTGACTGACACCTTGACTTTGG - Intergenic
948560110 2:238846867-238846889 CTTGCCTGACAGCCCGGCTCAGG + Intergenic
948788928 2:240367414-240367436 CTTGCATGGCAGCTGGGCCAGGG - Intergenic
1170847409 20:19974209-19974231 CTTGGCTGGCAGCTGCACTGTGG + Intronic
1172918992 20:38465688-38465710 ATTCCCTGAAAGCTTGACTAGGG + Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1174264908 20:49324280-49324302 CTGGCTGGACAGCTGGACCAAGG - Intergenic
1176069044 20:63216506-63216528 CTGGTCCGACAGCTGGGCTACGG + Intergenic
1182562282 22:31169946-31169968 CTTGTCTTCCAGCTGGCCTAAGG + Intronic
1182870987 22:33647440-33647462 CTTTCCTGCCAGCTGGAATGTGG + Intronic
1183865868 22:40703810-40703832 CTTGCCAGACAAATGGACTTTGG + Intergenic
949162817 3:901007-901029 CATGCCTGACAGCCAGACTAGGG + Intergenic
950196223 3:11011073-11011095 CTTGCCTGCCATCTGGTCCAGGG + Intronic
950491050 3:13305344-13305366 CTTGCCTGGCACCTGCACTGGGG - Intergenic
954613256 3:51957178-51957200 CTTCCCTGACATCTGCACCAAGG + Exonic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
958499518 3:94887657-94887679 CTTGCCTGGCAACTGCATTAGGG - Intergenic
959813270 3:110644390-110644412 TCTGCCTGACAGCGCGACTAAGG + Intergenic
963074831 3:141336168-141336190 CTTGCCTGACTGCTGGTCGATGG + Intronic
965003495 3:162987387-162987409 CTTGCCGGCCAGCTGGAGTTCGG + Intergenic
966769732 3:183492950-183492972 CTTGCCTGAGAGCTGGATTCCGG - Intronic
967842160 3:194014917-194014939 TTTGCCAGACAGCTGTTCTAGGG + Intergenic
968431258 4:560419-560441 CCTGCCTTGCAGCTGGAATAGGG + Intergenic
969091705 4:4698817-4698839 CTAGCTTGAGAGCTGGAGTAAGG + Intergenic
969706189 4:8793520-8793542 CTTTCCTGACACCTGGACAGAGG - Intergenic
980525846 4:133990545-133990567 TTTGCCTGACAGCCTGTCTAGGG + Intergenic
980798496 4:137716302-137716324 TTTACCTGACAGCTGGGTTATGG - Intergenic
982881118 4:160717673-160717695 CTTGCCTGAGAGCTGAAATGTGG - Intergenic
983929909 4:173442105-173442127 ATTCCCTGACAGCTGCACTCTGG + Intergenic
984812307 4:183806330-183806352 CATGCCAGAGAGCTAGACTAAGG - Intergenic
985178424 4:187228436-187228458 CTTGTCTAACAGCTGCACCAGGG - Intergenic
987877470 5:23697134-23697156 TTTGCCTGACAGCATGGCTAGGG + Intergenic
987967051 5:24890993-24891015 CTTGCATGACAGCTGCCTTAGGG - Intergenic
988325368 5:29759061-29759083 TTTGCCTGACAGCAAGGCTAGGG + Intergenic
988338082 5:29932292-29932314 CTTTCCTTACAGCTGTTCTAAGG - Intergenic
991001995 5:61792161-61792183 CTTGGCTGAGGGCTGGGCTATGG + Intergenic
997202010 5:132016201-132016223 CATGCCTGACAGATGGACAATGG - Intergenic
1001879455 5:175230799-175230821 GTTTCCTGACAGCTGGCCGAGGG - Intergenic
1003054240 6:2804518-2804540 TTTGCCTGTCACCTTGACTAAGG + Intergenic
1005992297 6:30910879-30910901 CCTGGCTGACAGCTGCACTGGGG - Exonic
1006790677 6:36699110-36699132 CTTGCCTGACAGGTGGCCTGGGG - Intronic
1006792891 6:36715388-36715410 CTTCCCTGAGGGCTGGACCAGGG + Intronic
1006797188 6:36739297-36739319 CTTGCCTGGCAGGGGGACTGAGG - Intergenic
1007270164 6:40630289-40630311 CATGCCTGACAGATCGACTAGGG + Intergenic
1010070777 6:71742065-71742087 CTTGCATGATAGCTGGAACAAGG + Intergenic
1011282620 6:85691594-85691616 CTTGCCTGACAGCTGACATAGGG - Intergenic
1016558982 6:145373143-145373165 CTTGCTGCACAGCTGGAATAAGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020891824 7:13888067-13888089 CTGGCCTGATAGCTTTACTAAGG - Intergenic
1023439323 7:40170060-40170082 CTTGCATGCCAGAAGGACTAAGG - Intronic
1027876008 7:83769528-83769550 CCTGCCTGACAGCAGGCATATGG + Intergenic
1027984591 7:85271085-85271107 CTTGCCTGACAGCAAATCTATGG + Intergenic
1030115290 7:106058339-106058361 CTTCCCTGAGAGCTGGGCTCAGG + Intergenic
1030127014 7:106163351-106163373 CTTGCCTGTCAGCAGGAAGAGGG + Intergenic
1031106637 7:117551759-117551781 CTTGACTGAAAGCTGGCTTATGG + Intronic
1032456554 7:132077400-132077422 CATTCCTGACAGCTGGTCTCAGG - Intergenic
1032623461 7:133562329-133562351 CTAGCCTGACCTCTGGATTAGGG + Intronic
1032687317 7:134248652-134248674 CTTGCATAACAAATGGACTAGGG + Intronic
1033776711 7:144619636-144619658 TTTGCCTGTCAGTGGGACTAAGG - Intronic
1036548989 8:9800242-9800264 TTTGCCTGACAGCTCAGCTAGGG - Intergenic
1036814475 8:11891142-11891164 CTTGCCTGACACCTTGAGTGTGG + Intergenic
1038439659 8:27562549-27562571 CTTGCCTAACAGCTGGTGCAAGG - Intergenic
1040989466 8:53334738-53334760 TTTGCCTGACAGCACGGCTAAGG + Intergenic
1041092141 8:54312197-54312219 CTTGGCTGAAAGCAGGACTCTGG + Intergenic
1043317178 8:78937404-78937426 CCAGACTGACAGGTGGACTATGG - Intergenic
1043536706 8:81213127-81213149 CTTGGCTGACACCTGGATTTTGG + Intergenic
1044288598 8:90440397-90440419 CTTGTCTGCCAGCTTCACTAAGG + Intergenic
1048426934 8:134331659-134331681 CTTGCCTGAAGGCTGGATTTGGG - Intergenic
1048622277 8:136147205-136147227 CTTCTCTGACAGGTGGATTAGGG - Intergenic
1188895969 X:35668702-35668724 CTTGCCTGACAGCATGGCTACGG - Intergenic
1189306203 X:39988581-39988603 CTTGGCTGACACCTTGACTTTGG - Intergenic
1195574701 X:106436867-106436889 ATTGCCTGACAGCTGCAGTAAGG + Intergenic