ID: 918586326

View in Genome Browser
Species Human (GRCh38)
Location 1:186193173-186193195
Sequence CCCCATTGTTGCAAGATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 87}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918586326_918586338 13 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586338 1:186193209-186193231 GATGAGAAGGGAGGAAGGGAGGG 0: 1
1: 5
2: 80
3: 949
4: 6583
918586326_918586339 16 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586339 1:186193212-186193234 GAGAAGGGAGGAAGGGAGGGAGG 0: 7
1: 198
2: 1859
3: 10433
4: 33341
918586326_918586337 12 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586337 1:186193208-186193230 GGATGAGAAGGGAGGAAGGGAGG 0: 1
1: 1
2: 53
3: 635
4: 4479
918586326_918586336 9 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586336 1:186193205-186193227 TGAGGATGAGAAGGGAGGAAGGG 0: 1
1: 0
2: 11
3: 174
4: 1730
918586326_918586330 1 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586330 1:186193197-186193219 AACCACCCTGAGGATGAGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 219
918586326_918586343 24 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586343 1:186193220-186193242 AGGAAGGGAGGGAGGGAGGGAGG 0: 1736
1: 9274
2: 15563
3: 24858
4: 72470
918586326_918586344 25 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586344 1:186193221-186193243 GGAAGGGAGGGAGGGAGGGAGGG 0: 1697
1: 9182
2: 15259
3: 25025
4: 40934
918586326_918586328 -9 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586328 1:186193187-186193209 ACAATGGGGCAACCACCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 120
918586326_918586335 8 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG 0: 1
1: 0
2: 9
3: 180
4: 2030
918586326_918586332 4 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586332 1:186193200-186193222 CACCCTGAGGATGAGAAGGGAGG 0: 1
1: 0
2: 6
3: 26
4: 393
918586326_918586342 21 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586342 1:186193217-186193239 GGGAGGAAGGGAGGGAGGGAGGG 0: 443
1: 7624
2: 14980
3: 24912
4: 39465
918586326_918586345 26 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586345 1:186193222-186193244 GAAGGGAGGGAGGGAGGGAGGGG 0: 114
1: 600
2: 1704
3: 4118
4: 12584
918586326_918586346 29 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586346 1:186193225-186193247 GGGAGGGAGGGAGGGAGGGGAGG 0: 106
1: 4853
2: 10436
3: 20584
4: 36509
918586326_918586340 17 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586340 1:186193213-186193235 AGAAGGGAGGAAGGGAGGGAGGG 0: 39
1: 1021
2: 7248
3: 21373
4: 36257
918586326_918586341 20 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586341 1:186193216-186193238 AGGGAGGAAGGGAGGGAGGGAGG 0: 528
1: 7897
2: 15471
3: 25747
4: 74132
918586326_918586329 0 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586329 1:186193196-186193218 CAACCACCCTGAGGATGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918586326 Original CRISPR CCCCATTGTTGCAAGATGCT TGG (reversed) Intergenic
901397067 1:8989184-8989206 CCCCATGTTTGGAAGATGCTGGG - Intergenic
913374849 1:118139865-118139887 CCCCATTGTGGCAGTATGATAGG + Intronic
917907400 1:179600547-179600569 CCCCATTGTTAAAAGATGCATGG + Intronic
917971310 1:180209858-180209880 CCTCAGTGTCCCAAGATGCTGGG + Intergenic
918586326 1:186193173-186193195 CCCCATTGTTGCAAGATGCTTGG - Intergenic
1063283451 10:4657325-4657347 CCCCATTGTTAAACGATGCATGG - Intergenic
1065009717 10:21410466-21410488 CCCGATTCTTCCAGGATGCTGGG - Intergenic
1081244353 11:40746357-40746379 CCCCAGTGTTGCTAGTTTCTGGG - Intronic
1083469647 11:62875011-62875033 CCTCATTCTTCCAAAATGCTGGG + Intronic
1084928490 11:72534559-72534581 GCACATTGTTGCAAGATACCTGG + Intergenic
1086851282 11:91812154-91812176 CCCCATAGTTGATAGAAGCTGGG - Intergenic
1089869515 11:121659613-121659635 CCCCAATGATGCAAGATCCCTGG - Intergenic
1092838253 12:12512625-12512647 CCATATTGTTGCAAAATGGTAGG + Intronic
1095885914 12:47188201-47188223 CCCCAATGGTGTTAGATGCTGGG - Intronic
1101212615 12:102549693-102549715 CCCCAGTGTCTCAAGATCCTGGG + Intergenic
1102532159 12:113554383-113554405 CCCCATTGTTGCTAGTCTCTGGG + Intergenic
1104201989 12:126598550-126598572 CTCTATTGTTGCCAGATGCAGGG - Intergenic
1121708970 14:96022846-96022868 CCCAAGTGTTGCCAGATTCTAGG + Intergenic
1122070565 14:99203041-99203063 CCCCACTGTGGCACGAAGCTGGG + Intronic
1127467705 15:59260375-59260397 CCCCATTGTTGCCAGATGAATGG - Intronic
1129598474 15:76983133-76983155 TCCCATTGTTCCAAGAGACTCGG - Intergenic
1130171892 15:81523396-81523418 CCCAATTCTTCCAGGATGCTGGG - Intergenic
1133672979 16:8042304-8042326 ACCCACTGTTGCAGGATGATGGG + Intergenic
1133790525 16:9006191-9006213 CCTCATTCTTCCAAGTTGCTGGG - Intergenic
1140600182 16:76466237-76466259 CCATGTTGTTGCAAGAGGCTGGG + Intronic
1147610506 17:41799319-41799341 ACCCATTATTCCAAGATTCTAGG + Intergenic
1148892039 17:50815029-50815051 GCTCATTGTTGAAAGAAGCTTGG + Intergenic
1152503332 17:80727932-80727954 CCCCATTGTGGGAGGATGCAGGG - Intronic
1153957894 18:10113636-10113658 CCCTGTTGCTCCAAGATGCTTGG - Intergenic
1160555666 18:79723404-79723426 CCCCATTGTGACAGGACGCTTGG + Intronic
1160589835 18:79937446-79937468 ACTCATCATTGCAAGATGCTAGG + Intronic
1161981638 19:7633184-7633206 CCCTATTGATGGGAGATGCTGGG - Intronic
1163203699 19:15787196-15787218 TCCCATTTTTCCAAAATGCTTGG + Intergenic
1164876893 19:31697416-31697438 CCTCATTGTCACAATATGCTTGG + Intergenic
1165022719 19:32937095-32937117 CCACATTGTTACAAGATCTTTGG - Intronic
1165262930 19:34636328-34636350 CCCCATTGTATCATGATGCCAGG - Intronic
1167739903 19:51318269-51318291 GCCCAGTGTTGGGAGATGCTGGG + Intronic
925896831 2:8478682-8478704 CACCTGTCTTGCAAGATGCTGGG - Intergenic
928947108 2:36781472-36781494 TCCCATTATTCCAAGATTCTTGG + Intronic
929718782 2:44344061-44344083 CATCATTGTTGAAAGAAGCTAGG - Intronic
932909530 2:75791345-75791367 CCACTGTATTGCAAGATGCTTGG - Intergenic
934094580 2:88587792-88587814 TCCCATTTTTGCCACATGCTAGG - Intronic
936281446 2:111143668-111143690 CCCACATGGTGCAAGATGCTGGG + Intronic
938622590 2:133072013-133072035 GCCCATTCTTACAAGATGCATGG + Intronic
940910829 2:159208601-159208623 CCACATTTTTCCATGATGCTTGG + Intronic
942844548 2:180407097-180407119 CCCCAAGGTTGCAAGATACCCGG + Intergenic
944127912 2:196315106-196315128 CCCCAGATTTGCAAGTTGCTTGG + Intronic
946227975 2:218274718-218274740 CCCCATTCTTGAAAGCTGCTGGG - Exonic
947327089 2:228991419-228991441 TCACATTGTTGCAGGATCCTTGG + Intronic
948673626 2:239584405-239584427 CCCCGCTGTTGCAAGGGGCTCGG - Exonic
1170787950 20:19483729-19483751 CCCCACAGTTGCAAGAAGCTGGG - Intronic
1173406780 20:42773262-42773284 CCTAATTGTTCCAAGATTCTTGG - Intronic
1174526620 20:51176912-51176934 GCACATTGTTCCACGATGCTGGG + Intergenic
1175234880 20:57502994-57503016 CACCAGAGTTGCAAGAGGCTAGG + Intronic
1181436453 22:22914016-22914038 CCCCATGGCTGCATGATGGTTGG + Intergenic
955663697 3:61328140-61328162 CCTAATTCTTTCAAGATGCTGGG - Intergenic
956207929 3:66773118-66773140 CCCCTTTGTTGACACATGCTAGG - Intergenic
958558932 3:95718151-95718173 CCCTATTGTTGAAAGATCATCGG - Intergenic
959967746 3:112375806-112375828 CCTGATTTTTCCAAGATGCTGGG - Intergenic
962732949 3:138299850-138299872 CACCAATGTTGGAAGATCCTTGG + Intronic
963908127 3:150791085-150791107 CCCTATGGTTGCAAGATGATGGG + Intergenic
964566170 3:158055548-158055570 CCTCAGTCTTCCAAGATGCTGGG - Intergenic
967962724 3:194938889-194938911 CCCCATTCTGGGCAGATGCTGGG - Intergenic
968655738 4:1777755-1777777 CCCCCTTGGTGGAAGAGGCTGGG - Intergenic
969239137 4:5888044-5888066 CCCCATTGTCCCCAGAGGCTGGG + Intronic
977675022 4:99737933-99737955 CCCCATTCTTGCAAGCCTCTAGG + Intergenic
979749599 4:124262415-124262437 CCCTATTGATGCAAGATGCAGGG - Intergenic
982326766 4:154136756-154136778 CCCAATTTTTCCAGGATGCTGGG - Intergenic
985082487 4:186280362-186280384 TCCCTTCGTTGCAGGATGCTTGG - Exonic
985530573 5:431523-431545 CCACAGTGGTGCAAGATGCAAGG + Intronic
989034529 5:37156158-37156180 CCCTGTGGTTGCAAGATGCTTGG - Intronic
989187161 5:38636717-38636739 CCCCAATGTTGCTAGATGGGAGG - Intergenic
989624871 5:43419760-43419782 AGCCATCATTGCAAGATGCTGGG - Intergenic
996724935 5:126666077-126666099 CCCCATTATCCCAAAATGCTTGG + Intergenic
999835670 5:155368040-155368062 CCCCATTGTTGCGACTTGCTGGG + Intergenic
1000880692 5:166693599-166693621 CCCCATTGTTGCAGGAAGTCAGG - Intergenic
1005771304 6:29075321-29075343 CCCCATTGTAGAAATAAGCTGGG - Intronic
1013228942 6:108143887-108143909 CCCCAGTGTCCCAAAATGCTGGG + Intronic
1021931142 7:25582416-25582438 CCTTATTGTTGCAAGATGGTGGG + Intergenic
1024178900 7:46869383-46869405 TCTCATTGCTGCAAGACGCTGGG + Intergenic
1029007233 7:97223374-97223396 CCCCATTGCTGTGAGATGTTTGG - Intergenic
1038380503 8:27088795-27088817 CACCATTGTTGCTACAGGCTTGG - Intergenic
1043762679 8:84088382-84088404 CCCCATTTTTAAATGATGCTAGG + Intergenic
1044570922 8:93717572-93717594 CCCCATTCTTCCTAGATGATTGG - Intronic
1045543898 8:103111351-103111373 GCCTGTTGTTGCCAGATGCTAGG + Intergenic
1046907203 8:119586711-119586733 CTCCATTGTTCCCGGATGCTGGG - Intronic
1052384451 9:27807437-27807459 CCCCTTTTATGCAAGATACTTGG - Intergenic
1056750849 9:89350043-89350065 CCTCATGGTTGAAAGAAGCTGGG + Intronic
1056916127 9:90747688-90747710 CCTCAGTCTTCCAAGATGCTGGG + Intergenic
1058316090 9:103568709-103568731 CCCCACTGTTACAAAATGATTGG + Intergenic
1059478107 9:114565405-114565427 CCTCATTCTTCCAAGTTGCTGGG - Intergenic
1060076134 9:120592154-120592176 CCCGATTCTTCCAGGATGCTAGG - Intergenic
1186226086 X:7400419-7400441 CCTCAGTCTTCCAAGATGCTGGG - Intergenic
1192707340 X:73540781-73540803 CCCCAAAATTGCAAGAAGCTGGG + Intergenic
1194226689 X:91269107-91269129 GCACATTGTTGCCAGAGGCTGGG - Intergenic
1195907863 X:109863301-109863323 CCCCCTAGTTGCCAGAGGCTAGG - Intergenic
1197087278 X:122493699-122493721 CCCCATTATTAAAAGGTGCTAGG - Intergenic
1198237133 X:134745932-134745954 TCCCTTTGTTGCAAGGTGCTGGG + Intronic
1199597468 X:149518199-149518221 CCTCAGTGTTGCAAAGTGCTGGG + Intronic