ID: 918586335

View in Genome Browser
Species Human (GRCh38)
Location 1:186193204-186193226
Sequence CTGAGGATGAGAAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2220
Summary {0: 1, 1: 0, 2: 9, 3: 180, 4: 2030}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918586326_918586335 8 Left 918586326 1:186193173-186193195 CCAAGCATCTTGCAACAATGGGG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG 0: 1
1: 0
2: 9
3: 180
4: 2030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918586335 Original CRISPR CTGAGGATGAGAAGGGAGGA AGG Intergenic
Too many off-targets to display for this crispr