ID: 918587450

View in Genome Browser
Species Human (GRCh38)
Location 1:186204125-186204147
Sequence CTAAGTCATCTCTACAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918587448_918587450 5 Left 918587448 1:186204097-186204119 CCTCTGGTCCTTCTTTTGTTTCT No data
Right 918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG No data
918587447_918587450 6 Left 918587447 1:186204096-186204118 CCCTCTGGTCCTTCTTTTGTTTC No data
Right 918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG No data
918587445_918587450 15 Left 918587445 1:186204087-186204109 CCCTTTTCTCCCTCTGGTCCTTC No data
Right 918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG No data
918587446_918587450 14 Left 918587446 1:186204088-186204110 CCTTTTCTCCCTCTGGTCCTTCT No data
Right 918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG No data
918587449_918587450 -3 Left 918587449 1:186204105-186204127 CCTTCTTTTGTTTCTTTGTTCTA No data
Right 918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918587450 Original CRISPR CTAAGTCATCTCTACAGCCC AGG Intergenic
No off target data available for this crispr