ID: 918598472

View in Genome Browser
Species Human (GRCh38)
Location 1:186322550-186322572
Sequence CACGTCCTACAGACTGCCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918598468_918598472 2 Left 918598468 1:186322525-186322547 CCTATTCCTGGAGTCAACTGAAG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG 0: 1
1: 0
2: 0
3: 7
4: 69
918598467_918598472 5 Left 918598467 1:186322522-186322544 CCACCTATTCCTGGAGTCAACTG 0: 1
1: 0
2: 1
3: 36
4: 620
Right 918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG 0: 1
1: 0
2: 0
3: 7
4: 69
918598470_918598472 -4 Left 918598470 1:186322531-186322553 CCTGGAGTCAACTGAAGGCCACG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG 0: 1
1: 0
2: 0
3: 7
4: 69
918598466_918598472 10 Left 918598466 1:186322517-186322539 CCATGCCACCTATTCCTGGAGTC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918598472 Original CRISPR CACGTCCTACAGACTGCCTT CGG Exonic
907348454 1:53804445-53804467 CACGTGCTAGGCACTGCCTTTGG - Intronic
908798650 1:67856131-67856153 CACTTCCTCCACTCTGCCTTTGG + Intergenic
908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG + Intergenic
915687459 1:157648897-157648919 CTCAGCCTAGAGACTGCCTTAGG + Intergenic
917441899 1:175075814-175075836 CACATCCTACAGCCTGTCTGAGG + Intronic
918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG + Exonic
921560432 1:216651922-216651944 CACATCCCACACACTGCCATTGG - Intronic
921757391 1:218874723-218874745 CACTTCTTGCAGACAGCCTTTGG + Intergenic
1063311562 10:4957327-4957349 AACTTCCTACATATTGCCTTAGG + Intronic
1071315949 10:84398166-84398188 CACCTTCTAAAAACTGCCTTTGG + Intronic
1075590599 10:123688359-123688381 CACGGCCTACAGTCATCCTTTGG - Exonic
1075675875 10:124295414-124295436 AACGTCCTGGAGACAGCCTTAGG - Intergenic
1081727972 11:45345757-45345779 CTCTGCCTCCAGACTGCCTTTGG - Intergenic
1082760585 11:57123568-57123590 CACGTGCAGCAGACAGCCTTTGG - Intergenic
1083374200 11:62206362-62206384 CTGCTCCTACAGGCTGCCTTGGG + Intergenic
1087528423 11:99348549-99348571 TCCAACCTACAGACTGCCTTCGG + Intronic
1088176671 11:107060439-107060461 CACGTTCTACAGGATGCCTTTGG - Intergenic
1088285850 11:108186743-108186765 CAAGTCCTACAGTCTGCACTAGG + Intronic
1095984364 12:47989679-47989701 TACACCCTGCAGACTGCCTTGGG + Intronic
1096722685 12:53535208-53535230 AAAGTCCTACAGACTGTCTGGGG - Intronic
1104729951 12:131099323-131099345 CACGACCTGCACACAGCCTTAGG - Intronic
1113676871 13:112213811-112213833 CATGTGCCACAGACTGCATTCGG + Intergenic
1114875929 14:26717701-26717723 TTCTTCCAACAGACTGCCTTTGG + Intergenic
1118392361 14:65306059-65306081 CCAGCCCTACAGACTGCTTTGGG + Intergenic
1122747904 14:103910513-103910535 CTCCACCTACAGGCTGCCTTCGG + Intergenic
1126325607 15:47473700-47473722 CACGTCTTCCAGACTGCCTGGGG + Intronic
1135788222 16:25369455-25369477 CAAGTCCTAGACACTGCTTTTGG + Intergenic
1139238997 16:65371129-65371151 CAGGTCCTGCAGACTTCCTCTGG - Intergenic
1145797685 17:27665513-27665535 CAGGTCCTACAGAGGGCATTTGG - Intergenic
1148850120 17:50550567-50550589 CACGTACTGCAGGATGCCTTTGG - Exonic
1152515572 17:80821867-80821889 CACGTGCCACAGACTGCCCTTGG + Intronic
1154499538 18:14988368-14988390 CACATTCCACAGACTGCCCTAGG - Intergenic
1155278912 18:24218075-24218097 AAAGTTCTACATACTGCCTTTGG - Intronic
1165484315 19:36086261-36086283 CAGGTCCTATTGACTGCCTGTGG - Intronic
1167533905 19:50036823-50036845 CAAGGCCAACAGACTGCCTCTGG - Intronic
929645209 2:43619397-43619419 GACCTCCTAGAGACTTCCTTGGG - Intergenic
935545430 2:104395525-104395547 AACCTGCTACAGACTGCCATGGG - Intergenic
936171594 2:110181364-110181386 CACCTCCTACAAAGTGCGTTTGG + Intronic
936515755 2:113180454-113180476 CCTGTCCTACAGCCTGCCTGTGG + Intronic
943113346 2:183635723-183635745 CACTTGCTACAGAATGGCTTAGG + Intergenic
947298007 2:228654733-228654755 CTCTTCCTACAGACTGCTTATGG - Intergenic
948646382 2:239407689-239407711 CCCGTGCCACAGTCTGCCTTTGG + Intergenic
1169217161 20:3800596-3800618 CATCTCCTACAGCCTGCCTGGGG - Intronic
1174530103 20:51204954-51204976 CACCCCCTGCAAACTGCCTTAGG + Intergenic
1176009045 20:62881988-62882010 CACATCCTGCAGACTCTCTTTGG - Exonic
1184506435 22:44906597-44906619 CAGGGCCTACAGCCTGCCTTAGG - Intronic
957458602 3:80487428-80487450 CACTACCTACAGACTGCCAAGGG - Intergenic
959085004 3:101842762-101842784 CCCATCCTCCAGACTGCCATCGG - Intronic
966670566 3:182521527-182521549 CACTTCCTACAGGCTAACTTAGG - Intergenic
969243328 4:5916357-5916379 CACGCCGAACAGACAGCCTTGGG + Intronic
974443862 4:61953853-61953875 CACGTTCTTCAGTTTGCCTTGGG + Intronic
975858626 4:78651884-78651906 CACGGCCCACAGACTGCATGTGG + Intergenic
976466421 4:85374325-85374347 CTTGTCCTACAGTCTTCCTTAGG + Intergenic
982118965 4:152120986-152121008 CAGGTCCTGCAGTCTGCCCTGGG + Intergenic
983997694 4:174205645-174205667 CATGTTCTACAAACTGCATTAGG - Intergenic
987605677 5:20132992-20133014 CTCTTCTTCCAGACTGCCTTTGG - Intronic
1002015035 5:176314384-176314406 CAAGACCAACAGACTTCCTTTGG + Intronic
1003444607 6:6173219-6173241 CACGTGCTACAGCTTGCCTTGGG - Intronic
1006188164 6:32192036-32192058 CACCTCCTCCAGACTCCCCTTGG - Intronic
1021318537 7:19182265-19182287 CTTGTCCTACAAACTGCCTTGGG + Intergenic
1021476611 7:21068774-21068796 CTCACCCTACAGACTGCCTATGG + Intergenic
1024509993 7:50196346-50196368 CCCTGCCTCCAGACTGCCTTTGG - Intergenic
1024700770 7:51901927-51901949 CCCTTCCTTCAGACTGCCTTGGG + Intergenic
1039049810 8:33483133-33483155 CAGGTCCTAGAGGCTGCCTGTGG - Intronic
1041855882 8:62454394-62454416 CACGGCCCACAGACTGCATGTGG - Intronic
1045136566 8:99226326-99226348 CAAATCCTTCAGACTGCTTTAGG + Intronic
1045358180 8:101407824-101407846 TACGTCATAAAGACTGACTTTGG + Intergenic
1051182402 9:14425046-14425068 CAATTCCTACAGAAGGCCTTGGG + Intergenic
1055014657 9:71603032-71603054 CACTTCCCCCAAACTGCCTTTGG + Intergenic
1062122567 9:134841629-134841651 CACCTGCCACACACTGCCTTAGG - Intronic
1062387891 9:136321587-136321609 CATGGCCTGCAGACAGCCTTGGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1195702974 X:107718568-107718590 CAAGGCCTTCAGACTGCATTTGG - Intronic
1197365552 X:125561608-125561630 CAGGTCCTCCAGACTGACATAGG + Intergenic
1197763275 X:130042587-130042609 CACACCCTACAAACAGCCTTTGG - Intronic
1199183337 X:144884447-144884469 CTCTACCTCCAGACTGCCTTTGG + Intergenic
1200083564 X:153591701-153591723 CACCACCTGCACACTGCCTTGGG + Intronic