ID: 918598970

View in Genome Browser
Species Human (GRCh38)
Location 1:186330436-186330458
Sequence GTGAACAAAAGGTGAACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918598970 Original CRISPR GTGAACAAAAGGTGAACTAC AGG (reversed) Intronic
901884438 1:12212960-12212982 ATAAACAAAATGTGATCTACAGG + Intergenic
903092737 1:20936960-20936982 GAGAATATAAGGTAAACTACAGG + Intronic
908086071 1:60635600-60635622 ATGAACAAAATGAGAAGTACTGG + Intergenic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910247186 1:85151686-85151708 GTGAAAAAAATGTGAGCTGCAGG + Intergenic
910604449 1:89067941-89067963 GTTGACAAAAGGTCCACTACTGG + Intergenic
914515747 1:148372642-148372664 TATATCAAAAGGTGAACTACTGG - Intergenic
915926374 1:160023198-160023220 GTGAACAGAAGATGAACCACTGG - Intergenic
918387515 1:184025049-184025071 TTGAACTAAAGGGGAACTGCTGG - Intronic
918598970 1:186330436-186330458 GTGAACAAAAGGTGAACTACAGG - Intronic
922433584 1:225581257-225581279 GTGAGGAAAAGAAGAACTACAGG - Intronic
923757221 1:236802729-236802751 GTCAAGAAAAGGTGAACCAAAGG + Intronic
923807987 1:237281491-237281513 GTGTGCAAGAGGTGAACTCCAGG - Intronic
1063655176 10:7981094-7981116 GTGAGAAAAAGGTGAAACACTGG + Intronic
1065305315 10:24362976-24362998 GTGAACAAAAGTGGAACTTTGGG + Intronic
1065417852 10:25508496-25508518 TACAACAAAAGGTGAACTAGAGG + Intronic
1065912338 10:30319551-30319573 GTCCACCAAAGTTGAACTACTGG + Intronic
1067400529 10:45969608-45969630 GGGAACTGAAGGTGAACTTCAGG - Intergenic
1067868873 10:49939165-49939187 GAGAACTGAAGGTGAACTTCAGG - Intronic
1070995446 10:80775507-80775529 GTGAACATGATGTTAACTACTGG + Intergenic
1075257645 10:120938386-120938408 GTGAATAAAAGATGCACCACAGG - Intergenic
1077251148 11:1561261-1561283 GTGAGTAACAGGTGAACTGCAGG - Intronic
1077277890 11:1725049-1725071 GAGAACAGAAGGATAACTACAGG + Intergenic
1087348117 11:96997089-96997111 ATGAACCAAAGGTGAAGTACTGG - Intergenic
1091250147 11:134137316-134137338 GGTAACAACAGGTGAACTAGAGG - Intronic
1093990247 12:25582165-25582187 GTGACCAAAAGAAGAATTACAGG + Intronic
1096056106 12:48653635-48653657 GTGAAGAAAAGCTAAACTGCAGG + Exonic
1098310016 12:69139194-69139216 GGGGAGAAAAGGTGAACTTCGGG + Intergenic
1098645249 12:72892423-72892445 TTGAACAAAAGGTGAAGAAATGG - Intergenic
1099134848 12:78884451-78884473 ATGAACATAAGGTGTACTAAAGG + Intronic
1100216292 12:92452327-92452349 GTGATCAAAAAATAAACTACAGG + Intergenic
1107850006 13:44561813-44561835 GTGAAAAAAAGTTGAAGTAAAGG + Intronic
1108560183 13:51635522-51635544 GAGGACAAAAGGTGAAATGCAGG - Intronic
1109192638 13:59344065-59344087 GTGAACAAAAGGGAGACTAAAGG + Intergenic
1111093883 13:83484030-83484052 ATGAACAAATGATGAACTTCAGG + Intergenic
1111468910 13:88650449-88650471 GTTCAAAAAAGGAGAACTACAGG - Intergenic
1112687063 13:101841890-101841912 GTGCAGAAAAGGTGAGCTCCTGG - Intronic
1114835014 14:26193766-26193788 GTGACCAAAAGGTGAAGAAGTGG + Intergenic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1116838565 14:49795779-49795801 GAGGACAAAAGGTAAACTTCAGG - Exonic
1117684272 14:58237506-58237528 GAGAAAAAAAGGAAAACTACAGG + Intronic
1123133806 14:106009552-106009574 GTGAACAACAGGCCACCTACAGG - Intergenic
1126066409 15:44829486-44829508 GTGAGCAAGAGGTGAACTCAGGG + Intergenic
1126093473 15:45071383-45071405 GTGAGCAAGAGGTGAACTCAGGG - Intronic
1129320056 15:74769638-74769660 GAGAACAGAAGTTGAACTCCTGG - Intergenic
1130435839 15:83898577-83898599 GTGGAACAAATGTGAACTACTGG - Intronic
1131651114 15:94400558-94400580 TTCAACAAAAGGTGAAGTTCAGG + Intronic
1132059207 15:98677662-98677684 GTGAACACAAGATGACCTCCAGG + Intronic
1135830531 16:25768960-25768982 GTGGACCAAAGGTCAACAACAGG - Intronic
1139412685 16:66776993-66777015 GTAAACAGAAGTAGAACTACAGG + Intronic
1144738480 17:17568150-17568172 GTAGACAAAAGGTGGACTACAGG - Intronic
1149794573 17:59507525-59507547 GTGAGCAATAGGTGATCTAACGG + Intergenic
1150611115 17:66733833-66733855 TAGATCAAAAGGTGAACCACAGG + Intronic
1155274001 18:24168623-24168645 GTGAACAAATCTAGAACTACTGG + Intronic
1159356760 18:67346091-67346113 GTGACCAAAAAATGAACTACAGG + Intergenic
1159653237 18:71002080-71002102 GTGAACAAAAGTTAAAGTGCAGG + Intergenic
1165868130 19:38951470-38951492 GTGATCAAGAGGTGACCAACAGG - Intronic
925934995 2:8748481-8748503 GTAAACTAGAGGTGAACTCCAGG - Intronic
926799450 2:16646803-16646825 TAGAACAAAAGGTGAATTAAAGG + Intronic
927384974 2:22522246-22522268 GAGCAGAAAAGGTTAACTACTGG + Intergenic
933864418 2:86502786-86502808 ATCAACAAATGGTGAACAACTGG + Intergenic
935314708 2:101820515-101820537 GTGACCAGAAAGTGAACTAATGG - Intronic
941324236 2:164093279-164093301 GTGAAGAGGAGGTCAACTACAGG + Intergenic
941883694 2:170506955-170506977 GTGAAGAAAAAGTGAAATAGAGG - Intronic
942522976 2:176823711-176823733 CTGAACAAAAGGTTAATTCCTGG - Intergenic
942623522 2:177874607-177874629 GAGAACAAGAAGTGAATTACTGG + Intronic
942714571 2:178877062-178877084 GTAACCAAAAAGTGAACTACAGG - Intronic
943148742 2:184081833-184081855 GTGAACAAGGGGAGAACTTCAGG + Intergenic
943182652 2:184562586-184562608 GTGTACAAAAGCTGAAGAACTGG - Intergenic
944867488 2:203876937-203876959 GTGAATAAAAAGTGTACTAGAGG + Intergenic
946606622 2:221412042-221412064 GTGAATACTAGGTGAGCTACTGG + Intergenic
947464522 2:230329918-230329940 ATGAACAAAATGTGGAATACAGG - Intronic
948509965 2:238457619-238457641 GTGAACAGAAGTTCAACTTCTGG - Intergenic
1177205184 21:18002045-18002067 GTGAATAAAAAGTGAGTTACTGG - Intronic
1177659604 21:24065437-24065459 GTGAACAAAGGGTGAACAAAGGG + Intergenic
1177834991 21:26178040-26178062 TACATCAAAAGGTGAACTACAGG - Intergenic
1178848661 21:36194851-36194873 TTGAAGAAAAGGTGCACTAAAGG - Intronic
1179462147 21:41543535-41543557 GAAATCAAAAGGTGAACTAGAGG + Intergenic
1179981294 21:44897254-44897276 GTGAACATTTGCTGAACTACAGG - Intronic
1185083113 22:48720680-48720702 GTGAACATAATGAGAACTTCTGG - Intronic
949396763 3:3622751-3622773 TTGGACAAAAGGTGAAATATAGG + Intergenic
958476251 3:94587027-94587049 GTGAACAAAATGAGAAGAACAGG + Intergenic
958619415 3:96537430-96537452 GTGCTCAATAGGTGAAATACAGG + Intergenic
961415789 3:126755680-126755702 ATGAATAAAAGGGGAGCTACTGG - Intronic
963542437 3:146609873-146609895 GTTTACAAAAGGTGAATAACTGG - Intergenic
967148463 3:186626586-186626608 GTGAATCAAAGGTGAACAAAAGG - Intergenic
969497967 4:7536858-7536880 GTGAACAAATGGTGACCTCGAGG - Intronic
970097581 4:12481274-12481296 GCAAAGAAAAGGTGAACTAATGG - Intergenic
971789666 4:31153133-31153155 GTGAATCAAAGCTGAATTACCGG + Intergenic
975911666 4:79274314-79274336 AAGAACAAGAGGTGAAGTACAGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977388925 4:96382917-96382939 GTGAGCAAGAGGTGAGCCACTGG - Intergenic
981571398 4:146154736-146154758 GTGAACTAAAGGTGAATTGCGGG - Intergenic
984006690 4:174319381-174319403 TTTAACAAAAGGTAAAATACTGG - Intronic
986116904 5:4784219-4784241 GTGATGACAAGGTGCACTACTGG - Intergenic
986858465 5:11900311-11900333 GTGATCAAAAGATAAACAACTGG + Intronic
986969485 5:13315459-13315481 GTGAAGAACAGGTGAACTTTAGG - Intergenic
987614716 5:20258846-20258868 GTAATCAAAAAGTGAACTCCAGG + Intronic
988237164 5:28560956-28560978 GTGAACATAATGTGGACTAAAGG + Intergenic
992101635 5:73413469-73413491 GTAAATAAAAGGTGAACTCAAGG + Intergenic
994199457 5:96956066-96956088 TTTCACAAAAGGTGAACTAATGG - Intronic
994609347 5:102017211-102017233 GTGACCAAAAGCTGAAGAACTGG - Intergenic
999583154 5:153062183-153062205 GTAAAGAAGAGGTGAACCACCGG - Intergenic
1001196439 5:169677412-169677434 TACATCAAAAGGTGAACTACTGG - Intronic
1010097279 6:72061626-72061648 GGGAACAAAGGGTGAACTCCAGG - Intronic
1014474594 6:121857024-121857046 GTGAACAAAAGGTGGTCAGCTGG - Intergenic
1017413667 6:154196090-154196112 GTGAATAAAATGTGAACCAGGGG - Intronic
1020778803 7:12492676-12492698 GTGAACAAATGTTCAACAACAGG + Intergenic
1025050915 7:55733895-55733917 TACAACAAAAAGTGAACTACAGG - Intergenic
1031393703 7:121247385-121247407 TAGAACAAAAGGTGAACAAGAGG + Intronic
1032266655 7:130374407-130374429 GAGAGCAAGAGGTGAACTGCAGG - Intergenic
1033927550 7:146482292-146482314 GTGAAGAAAAGGTAAATTAAGGG + Intronic
1037712087 8:21362759-21362781 GTGAACCAAAGGTGGCCTGCAGG - Intergenic
1039680676 8:39731773-39731795 GTGAAGTAAAGGTGAAGTAAAGG - Intergenic
1040974451 8:53174617-53174639 TACATCAAAAGGTGAACTACAGG + Intergenic
1042712527 8:71734233-71734255 TTGAACAAAATGTGGAGTACAGG - Intergenic
1043273553 8:78364608-78364630 TTGAACAAAAGGTCAAAGACAGG - Intergenic
1044140466 8:88645019-88645041 GTCCACAGATGGTGAACTACAGG + Intergenic
1044358128 8:91249286-91249308 GTGAATATAAGGGGAATTACTGG + Exonic
1052745280 9:32434337-32434359 TTGAAGAAAAGGTAAAATACTGG - Intronic
1058688270 9:107497491-107497513 GTGAAAAAAAAGTCAACTACAGG - Intergenic
1062571340 9:137186887-137186909 GTGGACTAAAGGTGGACTAAAGG - Intronic
1187105952 X:16241976-16241998 GTGAAAAAAAGGAAAACTAATGG - Intergenic
1188240975 X:27789541-27789563 GTGATCAAAAGATGAATTCCAGG + Intergenic
1188525744 X:31085983-31086005 GTGAATAAAGGGGGAGCTACAGG + Intergenic
1188927426 X:36061887-36061909 GTGAACAACAGGTGAAGGAGAGG - Intronic
1190462749 X:50694839-50694861 ATGAACAAAAGGAGAAAGACGGG + Intronic
1192086970 X:68109386-68109408 GTAAACAAAATGTGATATACAGG - Intronic
1192344278 X:70288682-70288704 GTGAAGAAATGGGGAGCTACTGG - Intronic
1197240467 X:124117875-124117897 ATGAACAAAAAATTAACTACAGG + Intronic
1198554427 X:137777615-137777637 CTGAACAAAAGCTGCAGTACAGG - Intergenic
1199699775 X:150366406-150366428 GTAATCAAAGGGTAAACTACTGG + Intronic
1201798826 Y:17931116-17931138 GTGAACTATTGGTGAACTATTGG - Intergenic
1201802727 Y:17974841-17974863 GTGAACTATTGGTGAACTATTGG + Intergenic
1202360129 Y:24099732-24099754 GTGAACTATTGGTGAACTATTGG - Intergenic
1202510648 Y:25570382-25570404 GTGAACTATTGGTGAACTATTGG + Intergenic