ID: 918601997

View in Genome Browser
Species Human (GRCh38)
Location 1:186375238-186375260
Sequence GCGCGCACTTCGGTCGCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918601997_918602003 4 Left 918601997 1:186375238-186375260 CCGCCCGCGACCGAAGTGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 918602003 1:186375265-186375287 CCGTTGGAAGCTACGAACCCTGG 0: 1
1: 0
2: 0
3: 2
4: 21
918601997_918602004 5 Left 918601997 1:186375238-186375260 CCGCCCGCGACCGAAGTGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 918602004 1:186375266-186375288 CGTTGGAAGCTACGAACCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 23
918601997_918602006 21 Left 918601997 1:186375238-186375260 CCGCCCGCGACCGAAGTGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 918602006 1:186375282-186375304 CCCTGGGAACCCGAGCTCAGAGG 0: 1
1: 0
2: 4
3: 17
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918601997 Original CRISPR GCGCGCACTTCGGTCGCGGG CGG (reversed) Exonic
901018984 1:6246392-6246414 GCACGGACTTCGGTGGTGGGAGG + Intergenic
904831003 1:33306795-33306817 GCGCCCACAGCAGTCGCGGGCGG + Exonic
918601997 1:186375238-186375260 GCGCGCACTTCGGTCGCGGGCGG - Exonic
921692270 1:218164937-218164959 GCGCGCCCTCCAGTCCCGGGCGG + Intergenic
922937847 1:229434778-229434800 GCGCGCCCTCCGGCCGCCGGTGG - Intergenic
923684101 1:236142301-236142323 GCGCGCACTGCGGGAGCGCGCGG + Intergenic
1082838167 11:57667073-57667095 GCTCGCACTCCGGGGGCGGGAGG + Intergenic
1083933346 11:65857834-65857856 GCGCGGACACCGGCCGCGGGGGG - Intronic
1086064723 11:82733122-82733144 GCGGGCACTGGGGGCGCGGGAGG - Exonic
1088869009 11:113875604-113875626 GCGCGCGCTGCGGGCGGGGGCGG - Intergenic
1119240832 14:73058499-73058521 GCGTGCACTGCGGCCGGGGGCGG - Exonic
1132570616 16:642370-642392 GCGGGCGCTCCGGGCGCGGGGGG + Intronic
1132807720 16:1782750-1782772 GCGCGCACATTGGACCCGGGTGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
947860500 2:233354482-233354504 GCGCGCACCGCGGGCGGGGGCGG - Intergenic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1172793373 20:37521196-37521218 ATGCGCACTTAGGTGGCGGGCGG + Exonic
1174607126 20:51768745-51768767 GCGCGCACGGCGGGCGTGGGCGG - Intergenic
1179150655 21:38805889-38805911 GCGCGCTCTTCAGGAGCGGGAGG - Intronic
1180823195 22:18846269-18846291 GCGAGCACAAAGGTCGCGGGAGG - Intergenic
1181123619 22:20689368-20689390 GCGGGCACAAAGGTCGCGGGAGG - Intergenic
1181189549 22:21128277-21128299 GCGAGCACAAAGGTCGCGGGAGG + Intergenic
1181399862 22:22644726-22644748 GCGGGCACAAAGGTCGCGGGAGG + Intronic
1181707822 22:24659404-24659426 GCGGGCACAAAGGTCGCGGGAGG + Intergenic
1183713361 22:39519834-39519856 GCGCGTCCTTCGGTTGCGGGTGG - Intronic
1184664183 22:45978699-45978721 GGGCGCAGCTCGGGCGCGGGCGG + Intergenic
1203217296 22_KI270731v1_random:13215-13237 GCGAGCACAAAGGTCGCGGGAGG + Intergenic
1203273333 22_KI270734v1_random:72175-72197 GCGGGCACAAAGGTCGCGGGAGG - Intergenic
994486076 5:100388189-100388211 GCGGGCACAAAGGTCGCGGGAGG - Intergenic
1010204402 6:73309770-73309792 GCGGGCTCTGCGGTGGCGGGAGG - Exonic
1022923442 7:35037762-35037784 GCGCGGACTTCCGGCGCAGGCGG + Intronic
1025208757 7:57008930-57008952 GCGCGCACTGCGGGCACGCGGGG - Intergenic
1036739362 8:11347392-11347414 GTGCGGATTTCGGTCGCGTGCGG + Intergenic
1049396441 8:142403190-142403212 GCGCGCACGCCGGCGGCGGGAGG - Intronic
1049641658 8:143718741-143718763 GTGCGCACTGCAGTCGGGGGTGG - Intronic
1050094251 9:2047327-2047349 CCGGGCACTGCGGCCGCGGGCGG - Exonic
1053149217 9:35732225-35732247 CCGCGCTCTATGGTCGCGGGGGG + Exonic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic
1200128692 X:153830003-153830025 GGGCGCGCTTCCGTCCCGGGAGG - Intronic