ID: 918605163

View in Genome Browser
Species Human (GRCh38)
Location 1:186416158-186416180
Sequence ACCAGCACGTTGCAGTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918605163 Original CRISPR ACCAGCACGTTGCAGTACAT GGG (reversed) Intronic
900995665 1:6121980-6122002 ACCAGCACTTTGCAGTGTGTTGG - Intronic
910103565 1:83605146-83605168 ACCAGAACTTTGGAGTACAGAGG + Intergenic
918605163 1:186416158-186416180 ACCAGCACGTTGCAGTACATGGG - Intronic
1065436077 10:25705167-25705189 ACCAGCAGGCTGAAGTACAGTGG + Intergenic
1071092898 10:81940647-81940669 AGAAGCTCTTTGCAGTACATTGG + Intronic
1076508455 10:130994297-130994319 ACTAGCACTTTGCAGGACATGGG - Intergenic
1076618624 10:131772656-131772678 AACAGCACGTTGAAGTGCAGTGG + Intergenic
1095611588 12:44134896-44134918 ACCAGCACTTTGGATTCCATGGG - Intronic
1099586590 12:84524861-84524883 ACCAGCACGTTTGAAGACATGGG + Intergenic
1121607028 14:95248171-95248193 ACCAGCTCGTTGCAATGTATGGG + Intronic
1126101409 15:45120350-45120372 ACCAGCAGGTAGAAGTACCTGGG - Intronic
1133531697 16:6661028-6661050 TCCAGGTCGCTGCAGTACATAGG - Intronic
1136657477 16:31718822-31718844 ACCAGCACCTTGGAGTCCTTGGG + Intronic
1141253189 16:82377626-82377648 ACCAATACCTTTCAGTACATAGG - Intergenic
1149218299 17:54384967-54384989 ACCAGCAGGATGCAGAAAATGGG - Intergenic
1156382936 18:36580366-36580388 ACCAGCACAGTGCAGAACACAGG - Intronic
929812267 2:45200760-45200782 TCCTGCACGTTGCAGCACACTGG + Intergenic
948411564 2:237766528-237766550 ACCAGCACCCTGCAGGACGTTGG + Intronic
1170886158 20:20341373-20341395 AACAGCATGTTGCAGCACAAAGG + Intronic
1177631388 21:23733710-23733732 TCCAGCAAGTTGCAGTTTATTGG + Intergenic
1179344717 21:40546048-40546070 ACCAGGACCTGGCAGTGCATAGG + Intronic
949658351 3:6248019-6248041 ACCAGCATGTAGTAGTACCTGGG + Intergenic
950093312 3:10312671-10312693 GCCAGGATGTTGCCGTACATGGG + Exonic
958732088 3:97970943-97970965 ACAAGCACGGTGTGGTACATAGG + Intronic
986647145 5:9928485-9928507 GCCACCACGTTTCAGTCCATGGG - Intergenic
987274504 5:16347753-16347775 ATCAGCAAGTTGAAGAACATTGG + Intergenic
990260779 5:54020288-54020310 ACCACCACCTTGCAGTACCAAGG + Intronic
993115363 5:83714104-83714126 TCCAGCACAGTGCAGAACATGGG - Intronic
998712105 5:144838162-144838184 GCCAGCACTTTGCCATACATAGG + Intergenic
1000072298 5:157752080-157752102 ACTTGCACTTTACAGTACATGGG + Intronic
1021636493 7:22699240-22699262 AGCAGGACCTTGCAGGACATGGG + Intergenic
1023375923 7:39554876-39554898 ACCAGAAAGTGGCAGAACATTGG + Intergenic
1028785905 7:94794400-94794422 ATCTGAACGTTGCAGTACATAGG + Intergenic
1031335678 7:120528580-120528602 ACCAGCAACTTTTAGTACATGGG + Intronic
1032688701 7:134260939-134260961 CCCAGCACGTTGCAGTGATTTGG - Intronic
1034163194 7:149007258-149007280 ACCAGAACATGGCAGTACCTTGG - Intronic
1044010009 8:86983372-86983394 AGCAGCATGATGCAGTAAATTGG + Intronic
1045943858 8:107771916-107771938 GCCAGTAGGTTGCAGTACATAGG - Intergenic
1055298312 9:74856398-74856420 TCCCCCACGTTGCAGTACAGTGG - Intronic
1059423979 9:114209476-114209498 GCCAGCACCATGCAGTCCATGGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1192627395 X:72744526-72744548 GCCAGCACCTTCCAGAACATTGG + Intergenic
1192654313 X:72976287-72976309 GCCAGCACCTTCCAGAACATTGG - Intergenic
1200308944 X:155057621-155057643 TCCAGCACGCTGCAGGACAAGGG - Exonic