ID: 918610631

View in Genome Browser
Species Human (GRCh38)
Location 1:186486604-186486626
Sequence TATGTATAATTTAGATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918610631_918610633 9 Left 918610631 1:186486604-186486626 CCATCAAATCTAAATTATACATA No data
Right 918610633 1:186486636-186486658 ACTTGTGAAGATGCCATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918610631 Original CRISPR TATGTATAATTTAGATTTGA TGG (reversed) Intergenic