ID: 918611564

View in Genome Browser
Species Human (GRCh38)
Location 1:186498195-186498217
Sequence TCCTGGATGACCGCTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918611564_918611568 12 Left 918611564 1:186498195-186498217 CCAACTACAGCGGTCATCCAGGA No data
Right 918611568 1:186498230-186498252 CCCTACCTGCTTTTTCAGCCTGG No data
918611564_918611570 13 Left 918611564 1:186498195-186498217 CCAACTACAGCGGTCATCCAGGA No data
Right 918611570 1:186498231-186498253 CCTACCTGCTTTTTCAGCCTGGG No data
918611564_918611571 14 Left 918611564 1:186498195-186498217 CCAACTACAGCGGTCATCCAGGA No data
Right 918611571 1:186498232-186498254 CTACCTGCTTTTTCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918611564 Original CRISPR TCCTGGATGACCGCTGTAGT TGG (reversed) Intergenic
No off target data available for this crispr