ID: 918611565

View in Genome Browser
Species Human (GRCh38)
Location 1:186498212-186498234
Sequence TAGGGTTCACAAGAGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918611565_918611570 -4 Left 918611565 1:186498212-186498234 CCAGGAGCCTCTTGTGAACCCTA No data
Right 918611570 1:186498231-186498253 CCTACCTGCTTTTTCAGCCTGGG No data
918611565_918611571 -3 Left 918611565 1:186498212-186498234 CCAGGAGCCTCTTGTGAACCCTA No data
Right 918611571 1:186498232-186498254 CTACCTGCTTTTTCAGCCTGGGG No data
918611565_918611568 -5 Left 918611565 1:186498212-186498234 CCAGGAGCCTCTTGTGAACCCTA No data
Right 918611568 1:186498230-186498252 CCCTACCTGCTTTTTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918611565 Original CRISPR TAGGGTTCACAAGAGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr