ID: 918611571

View in Genome Browser
Species Human (GRCh38)
Location 1:186498232-186498254
Sequence CTACCTGCTTTTTCAGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918611565_918611571 -3 Left 918611565 1:186498212-186498234 CCAGGAGCCTCTTGTGAACCCTA No data
Right 918611571 1:186498232-186498254 CTACCTGCTTTTTCAGCCTGGGG No data
918611566_918611571 -10 Left 918611566 1:186498219-186498241 CCTCTTGTGAACCCTACCTGCTT No data
Right 918611571 1:186498232-186498254 CTACCTGCTTTTTCAGCCTGGGG No data
918611564_918611571 14 Left 918611564 1:186498195-186498217 CCAACTACAGCGGTCATCCAGGA No data
Right 918611571 1:186498232-186498254 CTACCTGCTTTTTCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918611571 Original CRISPR CTACCTGCTTTTTCAGCCTG GGG Intergenic
No off target data available for this crispr