ID: 918621033

View in Genome Browser
Species Human (GRCh38)
Location 1:186606102-186606124
Sequence GTTCAGCAGCACCGGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918621033_918621037 -7 Left 918621033 1:186606102-186606124 CCTAGAGCCCGGTGCTGCTGAAC No data
Right 918621037 1:186606118-186606140 GCTGAACTGCTCTTCTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918621033 Original CRISPR GTTCAGCAGCACCGGGCTCT AGG (reversed) Intergenic
No off target data available for this crispr