ID: 918623671

View in Genome Browser
Species Human (GRCh38)
Location 1:186633848-186633870
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918623671_918623679 29 Left 918623671 1:186633848-186633870 CCCACCAAATTGCCCTTAAAAAC No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918623671 Original CRISPR GTTTTTAAGGGCAATTTGGT GGG (reversed) Intergenic
No off target data available for this crispr