ID: 918623671 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:186633848-186633870 |
| Sequence | GTTTTTAAGGGCAATTTGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918623671_918623679 | 29 | Left | 918623671 | 1:186633848-186633870 | CCCACCAAATTGCCCTTAAAAAC | No data | ||
| Right | 918623679 | 1:186633900-186633922 | TTTGAGTAATAATAAAACTCTGG | 0: 261 1: 330 2: 181 3: 92 4: 382 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918623671 | Original CRISPR | GTTTTTAAGGGCAATTTGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||