ID: 918623679

View in Genome Browser
Species Human (GRCh38)
Location 1:186633900-186633922
Sequence TTTGAGTAATAATAAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1246
Summary {0: 261, 1: 330, 2: 181, 3: 92, 4: 382}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918623671_918623679 29 Left 918623671 1:186633848-186633870 CCCACCAAATTGCCCTTAAAAAC No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623673_918623679 25 Left 918623673 1:186633852-186633874 CCAAATTGCCCTTAAAAACTCTG No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623676_918623679 0 Left 918623676 1:186633877-186633899 CCCCGAATGCTCAGCGAGACTGA No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623672_918623679 28 Left 918623672 1:186633849-186633871 CCACCAAATTGCCCTTAAAAACT No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623674_918623679 17 Left 918623674 1:186633860-186633882 CCCTTAAAAACTCTGATCCCCGA No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623678_918623679 -2 Left 918623678 1:186633879-186633901 CCGAATGCTCAGCGAGACTGATT No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623677_918623679 -1 Left 918623677 1:186633878-186633900 CCCGAATGCTCAGCGAGACTGAT No data
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382
918623675_918623679 16 Left 918623675 1:186633861-186633883 CCTTAAAAACTCTGATCCCCGAA 0: 25
1: 139
2: 266
3: 228
4: 259
Right 918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG 0: 261
1: 330
2: 181
3: 92
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918623679 Original CRISPR TTTGAGTAATAATAAAACTC TGG Intergenic
900756766 1:4440758-4440780 TTTGAGTAATAGTAAAACTCTGG - Intergenic
901290889 1:8123505-8123527 TTTGAGTATTAACAAAACTCTGG - Intergenic
901383815 1:8893385-8893407 TTTGAGTAATAATAAAAGTCTGG + Intergenic
901413031 1:9098288-9098310 TTGGAATAATAATAAAACTCTGG + Intergenic
901461020 1:9391940-9391962 TCTGAGTAATAACAAAACTCTGG + Intergenic
901702201 1:11051447-11051469 TTTGAGTAATAGTAAAATTCTGG - Intergenic
903055136 1:20631055-20631077 TTTGAGTAATAATAAAACTCTGG + Intergenic
903514301 1:23900312-23900334 TTTGAGTAATAATAAAATTCCGG + Intronic
904112028 1:28133607-28133629 TTTGAGTAATGATAAAACGCTGG + Intergenic
904112454 1:28136873-28136895 TTTGAGTAATAATAAAACTCTGG - Intergenic
904303322 1:29570353-29570375 TTTGAGTAATAACAAAACTCTGG - Intergenic
904733648 1:32613629-32613651 ATTGAGTCATAATATAACTCTGG + Intronic
904979458 1:34484764-34484786 TTTGAATAATAATGAAACTAGGG + Intergenic
905189932 1:36225436-36225458 TTTTAGTGATAAGAAAACTGAGG - Intronic
906113831 1:43342255-43342277 TTTGGTTGATAATAAAAATCTGG + Intronic
906330939 1:44883672-44883694 TTTGAGTAATAATAAAATTCTGG + Intronic
906633641 1:47393153-47393175 TTTGAGTAATAATAAAACTCTGG - Intergenic
907071805 1:51542271-51542293 TTTAACAAATAATAAAACTGAGG + Intergenic
907133712 1:52119667-52119689 TTTGAGCAATAATAAAACTCCGG + Intergenic
907510065 1:54951255-54951277 TTTGAGTAATAATAAAACCCCGG - Intergenic
907688076 1:56633818-56633840 TTTGAGTAATTATCACTCTCTGG - Intronic
908069320 1:60440941-60440963 TTTGAGTAACAATAAAACTCTGG + Intergenic
908077590 1:60537463-60537485 TTCAAGTAATTAGAAAACTCAGG + Intergenic
908212579 1:61916732-61916754 TTCAAGTAATAATACAATTCCGG - Intronic
908240333 1:62183877-62183899 TTAGAGTAATAAGAAAAGTCCGG - Intergenic
908325670 1:63021111-63021133 TTTGTGTAATATAAAAAATCAGG - Intergenic
908554415 1:65243333-65243355 TTTGAGTAATAATAAAACTCTGG + Intergenic
908853736 1:68399494-68399516 TTTGTGTAAAAAAAAAAGTCAGG + Intergenic
909080374 1:71103788-71103810 TTTGAATAATAGAAAAGCTCTGG - Intergenic
909182559 1:72442947-72442969 TCTCAGTAATAATAAAAATATGG - Intergenic
909586037 1:77289485-77289507 TTAAAGTACTAATAAACCTCAGG + Intronic
909828845 1:80160157-80160179 TTTGAGGAATAAGAAAACTTGGG - Intergenic
909849791 1:80446318-80446340 TTTTATAAATAAGAAAACTCAGG - Intergenic
909944342 1:81646827-81646849 TTTAAGTAATAAGAAAATTGAGG - Intronic
909999678 1:82327336-82327358 TTTGAATAATAATAAAACTCTGG + Intergenic
910074288 1:83259106-83259128 TGTCAGTAATAATAAAACCAAGG - Intergenic
910250151 1:85188849-85188871 TTTAAATAGTAATAAAACCCAGG + Intronic
910314617 1:85868110-85868132 TTGAAGTAATAACAAAATTCAGG + Intronic
910532072 1:88248799-88248821 TTAAAGTAATAATAAAATTATGG - Intergenic
910794486 1:91084438-91084460 TTTGAGTAATAATAAAACTCTGG + Intergenic
910795193 1:91090869-91090891 TTTGAGTAATAATAAAACTCTGG + Intergenic
910810061 1:91226851-91226873 TTTGAGTAATAATAAGACTCCGG + Intergenic
910810162 1:91227592-91227614 TTTGATTAATAATAAAACTGTGG - Intergenic
910869015 1:91814697-91814719 AATGAGTCATAATAAAACTTAGG + Intronic
911245640 1:95513609-95513631 TTTTAATAATAATAAAATTTTGG + Intergenic
911331129 1:96526782-96526804 TTTGAGTAATAATAAAACTCTGG + Intergenic
911580467 1:99627639-99627661 TATGAGTAATGACAAAACTCAGG + Intergenic
911592834 1:99767680-99767702 GTTGAGTAATAATAGAACTCCGG - Intergenic
911696019 1:100891425-100891447 TTTGAGTAACACTAAAACTCTGG - Intronic
911747012 1:101451474-101451496 TTTCAGTAATAATAAAACTCTGG - Intergenic
911797693 1:102095108-102095130 TTTTAGTAATAATAGAACTCTGG + Intergenic
911854968 1:102865155-102865177 TCTGAGTAATAATAAAACTCTGG - Intergenic
912014632 1:105017630-105017652 TTTGAGTAAAAATGAAACTCCGG - Intergenic
912020669 1:105106088-105106110 TTTGAGTAATAATAAAACTCTGG - Intergenic
912461874 1:109839631-109839653 TTTGAGTAATAATAAAACTCTGG + Intergenic
912826013 1:112904048-112904070 TTTGAGTAATAATAAAACTCTGG - Intergenic
913289867 1:117262110-117262132 TCTGAGTAATAATAAAACTCCGG - Intergenic
913487128 1:119341887-119341909 TTTGAGTAATAATAAAACTCTGG - Intergenic
914001818 1:143700830-143700852 TTTGAGTAAAAATAAAAGTCTGG - Intergenic
914377630 1:147086229-147086251 ACTGAGTAATAATAAATCTCTGG - Intergenic
914511495 1:148336241-148336263 TTTGAGTAATAATAAAACTCTGG - Intergenic
915053708 1:153104910-153104932 TTTGAGTAGTTATGAAATTCTGG - Intronic
915210859 1:154308188-154308210 TTTCAGTAATAATAAAACTCTGG + Intergenic
915477658 1:156162506-156162528 GTTGAGGAATAATAACAGTCTGG + Intronic
915642035 1:157235235-157235257 TTTGTGTAATAATAAAATTCTGG + Intergenic
915917056 1:159946468-159946490 TTTGACTAATGAGAAAACTGAGG + Intergenic
916231227 1:162543464-162543486 TTTGAGTAATAATAAAACTCCGG - Intergenic
916674221 1:167052849-167052871 TTTCAGTAATAATAAAATTGTGG - Exonic
916688296 1:167167608-167167630 TTTGAGTAATAACAAAACTCAGG - Intergenic
916918424 1:169437015-169437037 TTTGAGTAATAATAAAACTCAGG - Intronic
916937553 1:169645143-169645165 TTTGAGAAATAATAGAATTGAGG - Intergenic
916945300 1:169720213-169720235 TTTCAGTAATAACAAAACCCCGG + Intronic
916961752 1:169895937-169895959 TTTGAGTAATAATAAAACTCTGG + Intergenic
917103520 1:171469417-171469439 TTTTAGTGAAAATAAAACACTGG - Intergenic
917374083 1:174329919-174329941 TTTGAATAATAATAAAGCTTTGG + Intronic
917805609 1:178610835-178610857 TTTGAGTAATAATAAAACTCTGG - Intergenic
917855744 1:179097992-179098014 TTTGAGTAATAATAAAACTCCGG + Intronic
918019899 1:180677310-180677332 TTTGAGTAATAATAAAACTCAGG - Intronic
918075880 1:181171220-181171242 TTTGAGTTATAATATAGCTCTGG - Intergenic
918452565 1:184673572-184673594 TTTGAGTAATAATAAAACTCTGG + Intergenic
918611047 1:186492394-186492416 ATTAATTAATAGTAAAACTCTGG - Intergenic
918623679 1:186633900-186633922 TTTGAGTAATAATAAAACTCTGG + Intergenic
918689936 1:187467479-187467501 TCTGACTGACAATAAAACTCTGG - Intergenic
918779656 1:188682536-188682558 TGTGATTTATAATAAATCTCAGG - Intergenic
918990972 1:191696620-191696642 TTTGAGTAATACTTACACTCCGG + Intergenic
918990988 1:191696806-191696828 TTTGAGGAATAATAAAACTCTGG - Intergenic
919105363 1:193143601-193143623 TTTTAATACTAATAATACTCAGG - Intronic
919211892 1:194497569-194497591 TTTGAATAATAATAAAAAAAAGG + Intergenic
920241614 1:204556065-204556087 TTTGAGTAATAATAAAACTCTGG + Exonic
920244384 1:204576774-204576796 TTTGAGTAATAATAAAACTCCGG - Intergenic
920538129 1:206754144-206754166 TTTGAGGAATAACAAAATCCAGG - Intergenic
920760472 1:208779439-208779461 TGGGAGTAAAAATAACACTCTGG - Intergenic
920772918 1:208906655-208906677 TTTGAGTAATAATAAAATTCCGG - Intergenic
921647361 1:217634268-217634290 TTTCAGTAACAATAAAACTCTGG - Intronic
921883105 1:220276113-220276135 TTTAAGTAATAATAAAACTCCGG + Intergenic
922535341 1:226375973-226375995 TTTGAGAAATATTAATACTAAGG - Intronic
922878126 1:228957205-228957227 TTTGAGTAATAATAAAACTCTGG + Intergenic
922978508 1:229804906-229804928 TCTGAGTGATAATAAAACTCTGG - Intergenic
922979133 1:229810376-229810398 TTCGAGTAATAATAAAATTCTGG - Intergenic
923089375 1:230727945-230727967 TCTGAGTAATAATAAAACTCTGG - Intergenic
923130684 1:231072136-231072158 TTTGAGTCATAATAAAACTCTGG - Intergenic
923709039 1:236370487-236370509 TTTGAGTAATAACAAAATTCTGG - Intronic
924270239 1:242324990-242325012 TTTGAGTAATAGCAAAACTCTGG + Intronic
924482973 1:244453366-244453388 TTTGAGTAATAATAAAACTCTGG + Intergenic
924809027 1:247384805-247384827 TCTGAGTAATAATAAAACTCTGG - Intergenic
1063221285 10:3970694-3970716 TTTGAGTAATAGTAAAACTCCGG + Intergenic
1063234624 10:4100234-4100256 TATGAGAAATGATAAAACTGAGG - Intergenic
1063302741 10:4866576-4866598 TTTGAGTAATAATAAAACACCGG - Intergenic
1064174562 10:13063158-13063180 TTTGAGTAATAACAAAACCCTGG + Intronic
1064422581 10:15203390-15203412 TATGAATAATGATAAAACCCTGG + Intergenic
1064611927 10:17112963-17112985 TTTGATTAAAAATAAAAACCAGG + Intronic
1064835991 10:19531365-19531387 TTTCAGTGATCATAAATCTCTGG - Intronic
1065247068 10:23769091-23769113 TTTGAGTAACAATAAAACTCTGG - Intronic
1065268833 10:24005633-24005655 TTTTAGTAATAACAATTCTCTGG - Intronic
1065478381 10:26165664-26165686 ATTGAGTGTTAACAAAACTCTGG - Intronic
1065679593 10:28215194-28215216 TTTGAATAATAATAAAACTCCGG + Intronic
1065753845 10:28912751-28912773 TTTGGATAATAAGAAAACACAGG + Intergenic
1065901310 10:30210619-30210641 CTTGAGTAATAATAAAATTCTGG - Intergenic
1065908247 10:30278778-30278800 TTTGTGTAATACTAAAACTTTGG + Intergenic
1066114845 10:32230505-32230527 TTTGAGTAATAATAAAACTCTGG - Intergenic
1066242884 10:33555043-33555065 ATTGTGAAATAATACAACTCTGG - Intergenic
1066714679 10:38273770-38273792 TTTGAGTAATAGCAAAACTCTGG - Intergenic
1066783394 10:38976939-38976961 TTTGAGTATTAGCAAAACTCTGG + Intergenic
1067399937 10:45962364-45962386 TTTGAGTAATAAGAAAACTCTGG + Intergenic
1067469239 10:46524005-46524027 TTTGAGTAATCATAAAACTCTGG - Intergenic
1067823353 10:49550286-49550308 TTTGAGTAATAATAAAACTCTGG - Intergenic
1067823669 10:49553173-49553195 TGTGAGTAATAATAAAACTATGG - Intergenic
1067868267 10:49931663-49931685 TTTGAGTAATAAGAAAACTCTGG + Intronic
1067895284 10:50172967-50172989 TTTGAGTCATAATAAAACTCTGG - Intergenic
1067953701 10:50769011-50769033 TTTGAGTCATAATAAAACTCTGG + Intronic
1068090275 10:52424963-52424985 TTTGAGTGATAATAAAACTCCGG - Intergenic
1068111801 10:52689117-52689139 TTTGAGTAATAATAAAACCCCGG + Intergenic
1068914807 10:62418599-62418621 TTTTCGTAATAAAAAAAATCAGG + Intronic
1068985457 10:63104144-63104166 TTTGAATAATAATGAAACTCTGG - Intergenic
1068985782 10:63106520-63106542 TTTGAGTAACAATAAAACTCTGG + Intergenic
1069201836 10:65628607-65628629 TTTACGTAATAATAAAGCTCTGG + Intergenic
1069439405 10:68414015-68414037 ACTGAATAATAATTAAACTCAGG - Intergenic
1069542177 10:69303454-69303476 TTTGAGTAATGATAAAACTCTGG - Intronic
1069558276 10:69412123-69412145 TTTGAGTAATTATAAAACTCTGG + Intronic
1069696607 10:70390981-70391003 TTTGAGTAATAATTAAACTCTGG + Intergenic
1070123099 10:73597638-73597660 TTTGAGTAATAATTAAACTCTGG + Intronic
1070141701 10:73742973-73742995 TTTGTGTAATAATAAAACTCTGG - Intergenic
1070460354 10:76661345-76661367 TAATAATAATAATAAAACTCCGG + Intergenic
1070490138 10:76968379-76968401 CTTGAGTAATAATAATTCTGAGG - Intronic
1071186701 10:83054445-83054467 TTCGAATAATAATACAACTCCGG + Intergenic
1071275587 10:84051460-84051482 TTTGAGTAATAATAAAACTCTGG + Intergenic
1071913955 10:90269141-90269163 CTTGAGAAATAATAAAGCTGAGG + Intergenic
1071943847 10:90618343-90618365 TTTAGGTAATAAGAAATCTCTGG - Intergenic
1072279521 10:93853113-93853135 TTTGAGTACTAATAAAACTCTGG + Intergenic
1072290170 10:93957712-93957734 TTTCAGGAATAATAAAATGCAGG - Intergenic
1072973473 10:100037572-100037594 TCTGAGTAATAATAAAACTCAGG + Intergenic
1073980640 10:109149689-109149711 TTTGAGTAATAATAAAACTGTGG - Intergenic
1074262491 10:111868506-111868528 TTTGAGTAATAATAAAACTCTGG - Intergenic
1074879491 10:117643559-117643581 TTTGATTGATAATATAGCTCAGG + Intergenic
1075447484 10:122523901-122523923 TTTGAGTAATAATAAAACTCTGG - Intergenic
1076099679 10:127766132-127766154 TTTGAGTAATAATAAAACTCTGG - Intergenic
1076653396 10:132005355-132005377 TTTGAGTGATAATGAAACGCTGG + Intergenic
1076703570 10:132287916-132287938 TTTGAGAAAGAACAAAACTGGGG + Intronic
1077335931 11:2004366-2004388 TTTGAGTAATAATAAAACTCTGG + Intergenic
1077380036 11:2228632-2228654 TTACTGTAATAACAAAACTCAGG + Intergenic
1077879700 11:6339296-6339318 TATGAATAATAATAAAACTCTGG - Intergenic
1077927280 11:6694263-6694285 TTTGAGTAATAATAAAACTCTGG + Intergenic
1077931956 11:6742494-6742516 TTTGAGTCATAATAAAACTCTGG + Intergenic
1078098833 11:8317171-8317193 TTTGAGTAATAATAAAAGTCTGG - Intergenic
1078303639 11:10159932-10159954 TTTGAGTAATGATAAAACTCTGG + Intronic
1078369302 11:10731780-10731802 TTTGAGTAATAATAAAACTCTGG + Intergenic
1078385586 11:10889293-10889315 TTTGAGTAATAATAAAACTCCGG - Intergenic
1078472481 11:11602554-11602576 TTTTAGTAATAACAAGAGTCTGG - Intronic
1078551614 11:12285014-12285036 TTTAAGTAATAATAAAATTCTGG - Intronic
1078751131 11:14164711-14164733 TTTAAGTGATAATAAAACTCCGG - Intronic
1079061539 11:17253001-17253023 TTTGAGTAATAATAAAACTCAGG - Intronic
1079233021 11:18666519-18666541 TTTGAGCAATAATAAAATTCTGG + Intergenic
1079607977 11:22393522-22393544 TTTTAATAAATATAAAACTCAGG + Intergenic
1079696841 11:23492057-23492079 TTTGAGTAATAATAAAATTCTGG + Intergenic
1080336937 11:31208398-31208420 TATGAGGAATTATAAGACTCAGG - Intronic
1080513435 11:32998267-32998289 TTTGAATAATAAAAAAATCCAGG - Intergenic
1080703456 11:34666060-34666082 TTTGAGTAATAATAAAACTCTGG + Intergenic
1080812394 11:35717540-35717562 TTTGAGTAATAATAAAACTCTGG + Intronic
1080880582 11:36316413-36316435 TTTGAGTAATAATAAAACCTTGG - Intronic
1081028484 11:38046727-38046749 TTTGAATCATAATAAAACTCCGG - Intergenic
1081291560 11:41331966-41331988 TTTGAACAATAATAAAAATAAGG - Intronic
1081316734 11:41639078-41639100 TTTGAGTAATAATAAAACTTTGG + Intergenic
1081530879 11:43958493-43958515 TTTGAGAGGTGATAAAACTCTGG + Intergenic
1081563369 11:44239722-44239744 TTTGAGTAATAATAAAACTCTGG - Intronic
1081972617 11:47210257-47210279 CTTGAGTAATAATAAAACTCCGG + Intergenic
1082025795 11:47570869-47570891 GTTGAGTAATATTAAAATTTTGG + Intronic
1082204297 11:49413407-49413429 TTTGGGGAAGAATAAAACCCAGG + Intergenic
1082272444 11:50186170-50186192 GTTGAGTAATAATAAAATTCTGG - Intergenic
1082867449 11:57912821-57912843 TTTGAGTAATAATAAAACTCAGG - Intergenic
1082938443 11:58678463-58678485 TTTGGGTAAAAATAAAATTAAGG - Intronic
1083025251 11:59545352-59545374 TTTGAGTAAAAATAAAACTCCGG - Intergenic
1083498561 11:63081321-63081343 TTTTAGTAATTATGAAACTAAGG - Intronic
1083503779 11:63136575-63136597 TTTGAGTAATAATAAAACTCCGG + Intronic
1083504478 11:63142883-63142905 TTTGAGTAGTAATAAAACTCTGG + Intronic
1084800941 11:71543497-71543519 TCTGAGTAATAATAAAACTCCGG - Intronic
1084940858 11:72612540-72612562 TTTTAGTAATGACAAAACTGAGG - Intronic
1085416777 11:76323734-76323756 TTTGAGTAATAATAAAACTCTGG + Intergenic
1085505631 11:77057052-77057074 CTTGAGTAATAATAAGACACCGG - Intergenic
1086348461 11:85921584-85921606 TTTGAGTAATAAAACAACGCTGG - Intergenic
1086592796 11:88535336-88535358 CTTTAGTATTAATAAAACACTGG + Intronic
1086650788 11:89287128-89287150 TTTGGGGAAGAATAAAACCCAGG - Intronic
1087503752 11:98994297-98994319 TTTTATTAATTATAAAATTCTGG + Intergenic
1087797824 11:102473029-102473051 TTTGAGTAATAATAAAACTCTGG - Intronic
1087870483 11:103287905-103287927 TTTGAGTAATAATAAAACTCCGG - Intronic
1087886939 11:103492858-103492880 TTTGAGTAATGATAAAACTCCGG - Intergenic
1087931856 11:103987130-103987152 TTTGAGTAATAATAAATCTCTGG + Intronic
1088157899 11:106831103-106831125 TTTCAGTAACAGTGAAACTCTGG + Intronic
1088221761 11:107577339-107577361 TTTGAGTAGTAATAAAACTCTGG + Intergenic
1088620845 11:111681914-111681936 TTTAAGAAATATGAAAACTCAGG + Intronic
1088801829 11:113313933-113313955 TTTGAGTAATAATAAAACTCCGG + Intergenic
1089222494 11:116885848-116885870 TTTGATAAATAAGAAAACTGAGG - Intronic
1089833146 11:121346718-121346740 TTTGAATAATAACAAAACTCCGG + Intergenic
1089926935 11:122268595-122268617 TTTTACTGATAAGAAAACTCGGG + Intergenic
1089956537 11:122576521-122576543 TTTGAACAATAATAAATCTCTGG - Intergenic
1089960107 11:122609486-122609508 TTTTAATAATAATAAATGTCAGG + Intergenic
1090715664 11:129428429-129428451 TTTGACTAAAAATCAAACCCAGG - Intronic
1090795410 11:130131448-130131470 TTTGGGGAATAAAAGAACTCAGG + Intronic
1090885467 11:130872493-130872515 TTTGTGTAATAAGAAATATCAGG + Intergenic
1091000440 11:131906518-131906540 TTTGGGTCATAATAAGACCCTGG - Intronic
1091069744 11:132551809-132551831 TTTGAGTAATAATAAAACTCTGG + Intronic
1202818915 11_KI270721v1_random:59548-59570 TTTGAGTAATAATAAAACTCTGG + Intergenic
1091397192 12:161328-161350 TCATAGTAATGATAAAACTCGGG - Intronic
1092324473 12:7515172-7515194 TTCCAGTAATAATTAAACACTGG - Intergenic
1092588569 12:9926278-9926300 CTGTAGTAATAATAATACTCAGG + Exonic
1092756583 12:11769243-11769265 AGTGAAAAATAATAAAACTCTGG - Intronic
1092893462 12:12991067-12991089 TTTGAGTAATAACAAACCTCTGG + Intronic
1093183200 12:15989575-15989597 TATAAATAACAATAAAACTCAGG - Intronic
1093189961 12:16062479-16062501 TTTGAGAAAAACTAACACTCTGG + Intergenic
1093354976 12:18155542-18155564 TTTGTGTGGTAATAAAACTCTGG + Intronic
1093616719 12:21234058-21234080 TTTGAATAATAACAAAACTCTGG - Intronic
1094431560 12:30374992-30375014 TTTGAGTAATAATAAAACTCCGG - Intergenic
1094770422 12:33652031-33652053 TTTGAGTAATAATAAAACCATGG - Intergenic
1094797498 12:33992922-33992944 TTTTAGAAATGAAAAAACTCAGG - Intergenic
1095135878 12:38602471-38602493 TTTGAGGATCAATAAAAATCTGG + Intergenic
1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG + Intergenic
1095360791 12:41336650-41336672 TTTGAGTAACAATAAAACTCCGG - Intronic
1095479822 12:42623262-42623284 TTTGAGTAATAATAAGACTCTGG + Intergenic
1095593070 12:43926679-43926701 TTTTAGTAATAGAATAACTCAGG + Intronic
1095662641 12:44755565-44755587 TTTGAGTGATGACAAAACTGTGG - Intronic
1095795923 12:46218706-46218728 TTTGAGTAATAATAAAACTCCGG - Intronic
1095887664 12:47205907-47205929 TTTGAGTAATAATAAAACCCTGG - Intronic
1096939723 12:55328653-55328675 TTTGAGTAATAATAAAAGTGGGG + Intergenic
1097340641 12:58434019-58434041 TTTCAGTAATAATAAAACTCTGG - Intergenic
1097497796 12:60364155-60364177 TTTGAGTACTAATAAAACTCTGG - Intergenic
1097599646 12:61675087-61675109 TTTGAGTAATAACAAGAATATGG + Intergenic
1098282792 12:68878657-68878679 CTTGAGTAATAGTAAAACTCCGG + Intronic
1098408613 12:70154097-70154119 TTTGAGTAATAATAAAACTCTGG - Intergenic
1098711656 12:73770160-73770182 TTTGAGTAATAATAAAGCTCCGG + Intergenic
1098765736 12:74486453-74486475 TTTAAATAATAATAAAACTCTGG + Intergenic
1098864820 12:75749577-75749599 TTTGAGTAACAATAAAACTCTGG + Intergenic
1099047486 12:77739897-77739919 TGTGAGTCATTATAAAACACTGG - Intergenic
1099112214 12:78575449-78575471 TTTGAATAATAATAAAACTCTGG + Intergenic
1099121006 12:78689108-78689130 TTTGAGTAATAATAAAACTCTGG + Intergenic
1099358291 12:81665243-81665265 TCTGAGTAATGAAACAACTCTGG - Intronic
1099420768 12:82457550-82457572 TTTGAGTAATAAAGCAACTGGGG - Intronic
1099564050 12:84217467-84217489 TTTTAGTAATAATAAAACTCCGG - Intergenic
1100223553 12:92533316-92533338 TTTGAGTAACAATAAAACTCTGG - Intergenic
1100890866 12:99124254-99124276 TTTAAGAAATAATCAGACTCTGG + Intronic
1102075353 12:110055643-110055665 TTTGAGTAATAATAAAACTCCGG - Intronic
1102192349 12:110998232-110998254 TTTGAGTAATATTAAAACTCTGG + Intergenic
1102192834 12:111001966-111001988 TTTGAGTAATAATAAAACTCTGG - Intergenic
1102436961 12:112931681-112931703 TTTGACAGATAATAAAACTGAGG + Intronic
1103093976 12:118118236-118118258 TTTCAGTAACAGTAAAACTCCGG + Intronic
1103133710 12:118489746-118489768 TTTGAGTAATAATAAGACTCTGG + Intergenic
1103539694 12:121657564-121657586 TTTGAGTAATAATACAACCCAGG + Intronic
1103539742 12:121657885-121657907 TAATAATAATAATAAAACTCAGG + Intronic
1103681412 12:122696972-122696994 TTTGAATAATGATAAAACTCTGG - Intergenic
1103683142 12:122710404-122710426 TTTGAATAATGATAAAACTCTGG - Intergenic
1103868158 12:124070395-124070417 TTTGAGTAATAATAAAACTCAGG - Intronic
1103876561 12:124132002-124132024 TTTCAGTAATAATAAAACTCTGG + Intronic
1103965441 12:124636254-124636276 TTTGAGTAATAGTAAAACTCTGG - Intergenic
1104320355 12:127745076-127745098 TTTGAGTAATAATAAAACTCCGG - Intergenic
1104340432 12:127943902-127943924 TTTGAGTAATGGTAAAACTCTGG - Intergenic
1104355639 12:128082751-128082773 TCTGAGTAATAATACAACTTAGG + Intergenic
1104364949 12:128168301-128168323 TTTGAGTAACAATAAAACTCCGG + Intergenic
1104539396 12:129648418-129648440 TTTAAGTAATAATAAAACTCCGG + Intronic
1104541570 12:129670638-129670660 TCTGAGTAATAATAAAACTCTGG + Intronic
1104641054 12:130467558-130467580 ATTGAGTAGTAATAAAACTCTGG + Intronic
1104784797 12:131442690-131442712 TTTGAGTAATGATAGAACTCTGG + Intergenic
1104852025 12:131881077-131881099 TTTGAGTGATAATAAAACTCTGG + Intergenic
1105221708 13:18335749-18335771 GCTGAGTATTAATAAAACTGTGG + Intergenic
1105348790 13:19598014-19598036 TTAGAGTAATAATAAAACCCTGG + Intergenic
1106122897 13:26876417-26876439 TTTGAATAATAATAAAACCCTGG - Intergenic
1106542356 13:30701221-30701243 TTTGAGTAATAATAAAACTCCGG + Intergenic
1106590523 13:31094647-31094669 TTTGAGTAATAATAAAACTCTGG - Intergenic
1106660368 13:31793465-31793487 AGTAAATAATAATAAAACTCAGG + Intronic
1106756332 13:32826515-32826537 TTTGAGTAATAATAAAACCCTGG + Intergenic
1107236360 13:38175680-38175702 TTTGAGTAATAATAAAACTCTGG - Intergenic
1107481181 13:40787564-40787586 TTTGAGTAATAATAAAACTCTGG + Intergenic
1107664514 13:42675038-42675060 TTTGAGTAATAATAAAACTCTGG - Intergenic
1107737922 13:43417593-43417615 GTTTAGAAATAATAAAACTAAGG - Intronic
1107868684 13:44727912-44727934 TTTAAGTAATAATAAAACCCCGG + Intergenic
1107949136 13:45446211-45446233 TGTGAGTAATAATAAAACTCAGG - Intergenic
1108007851 13:45970148-45970170 TTTTAGTAAAAATAAAAATATGG + Intronic
1108051547 13:46446154-46446176 TTTGAAAAATAGAAAAACTCAGG + Intergenic
1108134414 13:47339723-47339745 TCTGAGTAAAAAGAAGACTCTGG + Intergenic
1108253347 13:48588454-48588476 TTTGAGTAGTAATAAAACTCTGG + Intergenic
1108352799 13:49602656-49602678 TTTGAGTAATAATAAAACTCTGG - Intergenic
1108446850 13:50518083-50518105 TTAGAATAATTTTAAAACTCAGG - Intronic
1108507338 13:51124300-51124322 TTTGAGTAATAATAAAACTCAGG + Intergenic
1108831540 13:54485587-54485609 TTTGAATAATGACAAGACTCGGG - Intergenic
1108933133 13:55855845-55855867 TGTGAGCAATAACAAAATTCTGG - Intergenic
1109162993 13:58999885-58999907 TTTGAGTAATAATAAAACACTGG - Intergenic
1109300366 13:60584603-60584625 TTTGAGTAATAATAAAACTCTGG + Intergenic
1109300927 13:60589337-60589359 TTTGAGTAATAATAAAATTCTGG + Intergenic
1109544101 13:63819777-63819799 TTTGAAAAATAGAAAAACTCAGG + Intergenic
1109594407 13:64530931-64530953 TTTGAGGAATAATAAAATTCTGG + Intergenic
1109713156 13:66184904-66184926 TTTGAGTAATAATAAAACTTTGG - Intergenic
1109837760 13:67880939-67880961 TTTGAGTGCTTACAAAACTCTGG - Intergenic
1110498978 13:76203503-76203525 TTTAAGTAATAGAAAAACACAGG + Intergenic
1110973253 13:81794959-81794981 TTTTAGTAAAAATAACACTCTGG + Intergenic
1111164944 13:84446932-84446954 TTTGAGTAATAATAAAACTCTGG + Intergenic
1111190117 13:84795835-84795857 TTTGAATAATAATAAGACTCTGG + Intergenic
1111193229 13:84836414-84836436 CTTGGGTAATAATAAAAAACTGG + Intergenic
1111205579 13:85005634-85005656 TTTGACTAATAATACTATTCTGG - Intergenic
1111239118 13:85451583-85451605 TTTGAGTAATAATAAAAGTCTGG + Intergenic
1111239498 13:85456321-85456343 TTTGAGTAATAATAACACTCTGG + Intergenic
1111243153 13:85501962-85501984 TTTGGGTAATAATAAAACTCAGG + Intergenic
1111476980 13:88762291-88762313 TTTCAGTAATGATAAAACTCTGG + Intergenic
1111846667 13:93517933-93517955 TTTTAGTTATAGTAAAATTCAGG + Intronic
1112134964 13:96567509-96567531 AATGAGTAATAATAAAATACAGG + Intronic
1112332200 13:98485223-98485245 TTTCAGTAATAATAAAACTCTGG - Intronic
1112338627 13:98534864-98534886 TTTGAGTAACAATAAAACTCTGG + Intronic
1113103740 13:106750115-106750137 CTTGACTAATAATAAAACTTTGG - Intergenic
1113700371 13:112381638-112381660 TTTGAGTAATAATAAAACTCTGG - Intronic
1113701074 13:112388742-112388764 TTTGAGTAATAAAAAAACTCTGG - Intronic
1114235694 14:20821761-20821783 TTTGAGTAATAATAAAACTCCGG - Intergenic
1114446700 14:22794138-22794160 TTTGAGTAATAATAAAACTCCGG + Intronic
1114583665 14:23789110-23789132 TTTGAGTAATAATAAAACTCTGG + Intergenic
1114977875 14:28124251-28124273 TTTGAGTAATAATAAACCTCCGG + Intergenic
1115349016 14:32373229-32373251 TTTGAGTAATAATAAAACCCTGG - Intronic
1115646387 14:35371110-35371132 ATTTAGTAATAATAAAATTGTGG + Intergenic
1115658428 14:35466409-35466431 TTTGAGTAATAATAAAACTCTGG - Intergenic
1116119208 14:40700199-40700221 TTTGAGTAATAATAAAACTCTGG + Intergenic
1116172890 14:41426129-41426151 TTTGAGTAATAATAAAATTCCGG - Intergenic
1116201578 14:41804160-41804182 TTTGAGTAGTAATAAAACTCTGG - Intronic
1116848134 14:49883467-49883489 TTCGAATAACAATAAAACTCTGG + Intergenic
1117181191 14:53193516-53193538 TTTGAGTAATAATCAAACTCCGG + Intergenic
1117632493 14:57708373-57708395 TTTGAGTAATAATAAAACTCTGG + Intronic
1118273536 14:64365221-64365243 TTTGAGTAATAATAAAACTCTGG + Intergenic
1118918111 14:70125101-70125123 TTTGAGTTAAAATAAAGCTGGGG + Intronic
1118937838 14:70303857-70303879 TTTGAGTAATAATAACATTCTGG + Intergenic
1118941495 14:70343892-70343914 TTTGAGTAATAATAAAACTCCGG - Intronic
1119330280 14:73787990-73788012 TTTGAGCAATGATAAATTTCAGG - Intronic
1119418463 14:74492208-74492230 TCTGAGTAACAATAAAACTCCGG + Intronic
1119823833 14:77641101-77641123 TTTGAGTAATAATAAAATTCTGG + Intergenic
1119979571 14:79064264-79064286 GTGGAGTAATAATAAAAACCAGG + Intronic
1120004626 14:79342885-79342907 TTTGAGTAATAGTAAAACTCCGG - Intronic
1120016653 14:79481729-79481751 TTTGAGTGATAATCAAACTTTGG - Intronic
1120208907 14:81615238-81615260 TTTGAGTAATAACAAACCTCTGG - Intergenic
1120225525 14:81787129-81787151 TTTCAGTAATAATAAAACTCTGG + Intergenic
1120357617 14:83454611-83454633 TTTGAGTAATAATAAAACTCTGG + Intergenic
1120556824 14:85938013-85938035 TTTGAGTAGTAATAAAGCTCTGG + Intergenic
1120970576 14:90203746-90203768 TTTGAGTAACAGTAAAACTCCGG - Intergenic
1120998294 14:90433533-90433555 TTTGAGTAATAACAAAACTCCGG + Intergenic
1121822851 14:96985338-96985360 TTTGAGTAAGAACCAAACTTGGG - Intergenic
1122380199 14:101298082-101298104 TTTTAATAATAACAAAACTGTGG - Intergenic
1123138643 14:106054190-106054212 TTTCAGTAACAATAAAACTCTGG + Intergenic
1123478365 15:20608872-20608894 TTTGAATAATAATGAAACTCTGG + Intergenic
1123639649 15:22391513-22391535 TTTGAATAATAATGAAACTCTGG - Intergenic
1123816347 15:23983332-23983354 TTGGAGTAATAAGAAAACTCTGG - Intergenic
1123899005 15:24857813-24857835 TTTGAGTAATAATAAAACTATGG - Intronic
1124032786 15:26026664-26026686 TTTGAGTAACTATGAAATTCTGG - Intergenic
1124039833 15:26091219-26091241 CTTGAGTAATAATAAAACTCTGG - Intergenic
1125041301 15:35190317-35190339 TTTGAGTAATAATAAAACTCCGG - Intergenic
1125342558 15:38689163-38689185 TTTGAGTAATAATAAAACTCTGG + Intergenic
1125630443 15:41142726-41142748 TTTGATTAAGAATAAAGCTCTGG + Intergenic
1125631460 15:41151062-41151084 TTTAAGTAATAATACAACTCGGG + Intergenic
1125690656 15:41593579-41593601 TTTGAGTAATAATAAAACTCCGG - Intergenic
1126536374 15:49769897-49769919 TTTCAGTGATCATAAAACTGAGG - Intergenic
1126637042 15:50789631-50789653 TTTGAGTAATAATAAAACTCTGG - Intergenic
1126699279 15:51353301-51353323 TTCAAGTAATAATAAAACTCTGG + Intronic
1126898754 15:53288920-53288942 TTTGATTAAAAATAAAAAACAGG - Intergenic
1126928286 15:53616452-53616474 TTAGAGGAAAAATAAAACTTAGG - Intronic
1127086108 15:55425975-55425997 TTTGATTAGTAATAAAACGCTGG - Intronic
1127302905 15:57675083-57675105 TTTGAATAAAAAAAAAAATCAGG - Intronic
1127750921 15:62042302-62042324 TTTTAATAATTCTAAAACTCAGG - Intronic
1128101528 15:65004648-65004670 TTTGAGTAATAATAATGCCTTGG + Intronic
1128316500 15:66662606-66662628 TTTGACTAATAAAGAAACTGAGG - Intronic
1128641220 15:69339234-69339256 TTTGAGTAATAATAAAACTCCGG + Intronic
1129138779 15:73577933-73577955 TTTGAATAGTAATAAAACTCTGG + Intronic
1129339824 15:74878246-74878268 TTTGGGTAATAATAAAACTCCGG + Intergenic
1129377196 15:75141282-75141304 TCTGAATAATAATAAAACTCTGG + Intergenic
1129381293 15:75169159-75169181 TTTGAGTAATAATAAAATTCTGG + Intergenic
1130187175 15:81695345-81695367 TTTGAGAAAGAAATAAACTCTGG + Intergenic
1130657461 15:85801844-85801866 TTTGAGTAATAATAAAACTCCGG - Intergenic
1130833935 15:87630996-87631018 TTTGAGTAATAATAAAACTCCGG + Intergenic
1130837291 15:87663517-87663539 TTTGAGTAATAATAAAACTCCGG + Intergenic
1130999704 15:88929994-88930016 TTTGAGTGATAATAAAACTCCGG + Intergenic
1131007487 15:88990375-88990397 TTTAAGTAATAATAAAACTCCGG - Intergenic
1131436562 15:92427361-92427383 TTTGAGTAATATTATATTTCAGG - Intronic
1131577968 15:93611166-93611188 TTTGAGTCATAACAAAACTCTGG + Intergenic
1133524297 16:6589333-6589355 TTTGAGTAATAACAACACGCTGG - Intronic
1133680614 16:8116436-8116458 TTTGAGTAATAATAAAACCCTGG + Intergenic
1133694064 16:8244050-8244072 TTTGAGTAATAACAAAACTCTGG - Intergenic
1133900826 16:9972870-9972892 TTTGAGTCATAATAAAACTCTGG - Intronic
1133943025 16:10326274-10326296 TTTGAGTAATATTAAAACTCTGG - Intergenic
1134740630 16:16540542-16540564 TTTGAATAATAATAAAACTCAGG + Intergenic
1134838985 16:17386164-17386186 TTTGGGTAGCAGTAAAACTCAGG - Intronic
1134926872 16:18171630-18171652 TTTGAATAATAATAAAACTCAGG - Intergenic
1135034310 16:19064265-19064287 TTTGAGTAATAATAATATTCTGG - Intergenic
1135592801 16:23716740-23716762 TTTGAGTTTTCAGAAAACTCAGG + Intergenic
1135672769 16:24389323-24389345 TTTGAGCAATAATAAAACTCCGG + Intergenic
1135788503 16:25372188-25372210 TTTGATTAATAATGAAACTCTGG + Intergenic
1135802805 16:25514271-25514293 GTTGAGAAATAATAAAAATCTGG + Intergenic
1135855510 16:26006524-26006546 TTTGAATAATAGCAAAACTCTGG - Intronic
1135998364 16:27270410-27270432 TTTGAGTAATAATAAAACTGTGG - Intronic
1136044220 16:27602630-27602652 TTTGAGTAATCATAAAACTCTGG - Intronic
1136047530 16:27626310-27626332 GTTCAGTAATAACAAAACTCTGG - Intronic
1136598632 16:31269004-31269026 TTCGAGTGATAATAAAACTCTGG - Intronic
1136924413 16:34358632-34358654 TTTGAGTAATAGTAAAACTCTGG + Intergenic
1136980160 16:35053174-35053196 TTTGAGTAATAGTAAAACTCTGG - Intergenic
1137042489 16:35626000-35626022 TTTGAGTAATAATAAAACTCTGG + Intergenic
1137493268 16:48950700-48950722 TTTGTGTAATAATTAATCACAGG + Intergenic
1137513542 16:49122814-49122836 TTTGTGTAGTCATAAAAGTCTGG + Intergenic
1138112801 16:54337935-54337957 TTTTAGTGATAAGAAAACTGAGG - Intergenic
1138206424 16:55128727-55128749 TCTGAGTAATAATAAAACCCTGG - Intergenic
1138299325 16:55913070-55913092 TTTGAGTAATAATAAAATTCCGG - Intronic
1138315761 16:56068683-56068705 TTTTATTAATAAGAAAACTGAGG + Intergenic
1138459402 16:57139080-57139102 TTTGAGAAATAATAAAAGTCCGG - Intronic
1138544890 16:57711682-57711704 TTTGAGTAATAACAAAACTCTGG - Intronic
1138744913 16:59352382-59352404 TTTGAGTAAAAATAAAACTCCGG - Intergenic
1138749283 16:59399205-59399227 TTTGATTAATAATAAATTTATGG + Intergenic
1138760233 16:59534577-59534599 TTTGAGTAATAATAAAACTCCGG + Intergenic
1138966271 16:62087635-62087657 TTTGAGTAATAATAAAACTCTGG + Intergenic
1139109289 16:63869222-63869244 TTTGAGCAATAATATAAATAAGG + Intergenic
1139249231 16:65478961-65478983 TGTGAGTAATACGAAAACTGAGG + Intergenic
1139571592 16:67816373-67816395 TTTGAGTAAACTTACAACTCTGG + Intronic
1140028326 16:71312162-71312184 TTAGTATTATAATAAAACTCGGG - Intergenic
1140540056 16:75748769-75748791 TTTGAGTAATAATAAAACTATGG + Intronic
1140757961 16:78085641-78085663 TTTGGATAATAATAATACCCAGG - Intergenic
1140773842 16:78231387-78231409 TGTGACTAACAATAAAACACAGG + Intronic
1140848068 16:78908589-78908611 TTTGAGTAATAATAAAACTCTGG - Intronic
1141029721 16:80577310-80577332 TTTGACAAATAAGAAAACTGAGG + Intergenic
1141175585 16:81716813-81716835 TTTGAATAAAAATGAAACTCTGG - Intergenic
1141418267 16:83894134-83894156 TTTAAGTATTAAGAAAAATCAGG - Intergenic
1141753056 16:85972266-85972288 TTTGAGTAATAATAAAGCTCTGG + Intergenic
1141897580 16:86968378-86968400 TTTCATTTAAAATAAAACTCAGG - Intergenic
1142371045 16:89682555-89682577 TTTCAGTAATCATCAAATTCTGG - Intronic
1142507264 17:372457-372479 TTGGAGTAATAATAAAACTCCGG + Intronic
1142951037 17:3480304-3480326 TTTGAGTAATAATAAAACTCTGG - Intronic
1143170459 17:4926730-4926752 TTTGAGTAACAGTAAAACTCTGG - Intergenic
1143274324 17:5698953-5698975 TTTGAGTAATAATAGAACTCTGG + Intergenic
1143466750 17:7142184-7142206 TTTGAGAAATAGTAAAACTCTGG + Intergenic
1144529824 17:16026316-16026338 TTTGGGAAATAATACAAATCTGG - Intronic
1144551348 17:16243879-16243901 TTTGAGTAACAGTAAAACTCTGG - Intronic
1144556169 17:16284797-16284819 TTTGAGTAATAATAATACTCCGG + Intronic
1144559621 17:16311258-16311280 TTTGAATAATAATAATAATAAGG - Intronic
1145300450 17:21631212-21631234 ATTAGGTAATAATAGAACTCCGG + Intergenic
1145324882 17:21814750-21814772 TTTGAGTAATAATAAAACTCAGG + Intergenic
1145324982 17:21815394-21815416 TTTGAGTAATAATAAAACTCTGG - Intergenic
1145833178 17:27934047-27934069 TTTGAGTAATAATAAAACTCCGG - Intergenic
1145977169 17:28990866-28990888 TTTGAGTAGTAATAAAACTCTGG + Intronic
1146081226 17:29782530-29782552 TTTGAGTAGTAATAAAACTCTGG - Intronic
1146133771 17:30300361-30300383 TTTGAGTAATAATAAAGCTCTGG - Intergenic
1147020122 17:37524896-37524918 TTTGAGAAATAATTAGAATCTGG + Intronic
1147230530 17:39014751-39014773 TTTGAGAAATAATAAAACTCTGG + Intergenic
1147269902 17:39261779-39261801 TTTGTGTAATAATAAAACTGAGG + Intronic
1147343871 17:39773671-39773693 TTTGGGAAAGAATAAAAATCAGG + Intronic
1147363882 17:39947748-39947770 TTTGAGTAATAATAAAGCTCTGG + Intergenic
1147841629 17:43375943-43375965 TTTGGGTAATAATAAAACTCCGG - Intergenic
1148221847 17:45868508-45868530 GTTGAGTAATAATAAAACTCTGG + Intergenic
1148649824 17:49242173-49242195 TTTGAGTAATAATGAAACTCCGG - Intergenic
1148965847 17:51435417-51435439 TTTGAGTAATAATAAAACTCCGG + Intergenic
1149701394 17:58658169-58658191 TTTGAGTAACAATAAAACTCCGG + Intronic
1150348642 17:64424197-64424219 TTTGAGTAATAATAAAACTCTGG + Intergenic
1150451615 17:65273499-65273521 TTTGAGTAATAATAAAACTCTGG + Intergenic
1150881276 17:69031416-69031438 TTTCAGTAATATTTTAACTCAGG - Intronic
1150970922 17:70027189-70027211 TTGGATAAATAATAAAACTAAGG - Intergenic
1151284329 17:73099070-73099092 TTTGAGTAACAATAAAACTCCGG + Intergenic
1151628077 17:75289934-75289956 AATGAGAAATACTAAAACTCGGG - Intergenic
1151866062 17:76803774-76803796 TTTGAGTAATAATAAAACTTTGG + Intergenic
1152114141 17:78374582-78374604 TTTGAGTAATAATAAAACTCTGG + Intergenic
1153100993 18:1469257-1469279 TTTGAGTAGTAATAAAACTTGGG + Intergenic
1153399679 18:4669538-4669560 TCTGAGTAATAATGAAATTAAGG + Intergenic
1153868385 18:9294080-9294102 TTTGAGTCATAATAAAACTCTGG + Intergenic
1153886140 18:9468521-9468543 TTTGAGTAATGATAAAACTCTGG - Intergenic
1155171604 18:23270710-23270732 TGTGAGTAATAATAAAACTCTGG + Intronic
1155282434 18:24253544-24253566 TTTGAGTAATAATAAAACTCTGG - Intronic
1155669452 18:28351107-28351129 TTTGAATAATAATAAAACTCTGG + Intergenic
1155699949 18:28731382-28731404 TTTGAGTAATAATAAAACTCTGG + Intergenic
1155714098 18:28918452-28918474 TTTGAGTAATAATGAAACTCTGG + Intergenic
1155829621 18:30497346-30497368 TTTGAATAATAATTTAACTTTGG + Intergenic
1155932197 18:31719628-31719650 TTTCAGTAATAATAAAACTCTGG - Intergenic
1155962980 18:32010386-32010408 TTTGAGTAATAATAAAACTCTGG - Intergenic
1156000221 18:32377040-32377062 TTTTAGAAATAATGAAACTGAGG + Intronic
1156294335 18:35775867-35775889 TTTAAGTAATAATAAAACTCTGG + Intergenic
1156300385 18:35831289-35831311 TTTGAGTAGTAATATAACTTTGG + Intergenic
1156613824 18:38759814-38759836 TTTCAGGAATTATAAAACTATGG - Intergenic
1156658221 18:39312841-39312863 TTTGAATCATTATAAAAGTCTGG + Intergenic
1156902852 18:42321463-42321485 CTTGAGTAATAATAAAACTCAGG + Intergenic
1157167936 18:45375571-45375593 TTTGAGTAATAATAAAACTCTGG + Intronic
1157305296 18:46512477-46512499 TTTGAGTAATAATAAAATTCTGG + Intronic
1157921051 18:51712950-51712972 TTTGAGTCATAAGGAAACTTTGG - Intergenic
1158165341 18:54533602-54533624 TATGAGTAATAATAAAACTCTGG - Intergenic
1158482978 18:57837973-57837995 TTTGAGTAATAATGAAACTCTGG + Intergenic
1158743079 18:60165777-60165799 TTTCAGTAATAATAAAACTCCGG + Intergenic
1159121746 18:64179152-64179174 TTCGAGTAATAATAAAACTTTGG + Intergenic
1159165048 18:64688003-64688025 TCTGAGTAATAATAAAACTCTGG + Intergenic
1159664939 18:71146230-71146252 TCTCAGTAATAATACAATTCAGG - Intergenic
1159851764 18:73533852-73533874 TTTGAGTGATAATAAAACTCTGG + Intergenic
1159867257 18:73720834-73720856 TTTGATTCGTAATTAAACTCCGG + Intergenic
1159965766 18:74594865-74594887 TTTAAGTAATAATAAAACTCTGG - Intergenic
1161840319 19:6676242-6676264 TTTGAATAATAATAAAACTCTGG + Intergenic
1162881775 19:13665184-13665206 TTTTAGTCATAATAAAACTCTGG + Intergenic
1163065935 19:14795386-14795408 TTTGAGTAATAATAAAACTGCGG - Intronic
1163615006 19:18321966-18321988 TTTGAGCAATAATAAAACTCTGG + Intronic
1164489767 19:28697222-28697244 TTTTTCTAATAATAAAAATCAGG + Intergenic
1165187607 19:34035598-34035620 TTTGAGTAATAATAAAACTCGGG - Intergenic
1165853543 19:38865899-38865921 TTTGAGTAATAATACAACTCCGG - Intergenic
1166419922 19:42628752-42628774 TTTGAGTACTAATAAAACTCTGG + Intronic
1167212319 19:48140890-48140912 TTTGAGTAAAAATGAAACTCCGG + Intronic
1167256925 19:48436160-48436182 TGTGAGTGATAATAAAACTCCGG - Intronic
1167389836 19:49187713-49187735 TTTGAGTGATAATAAAACTGAGG - Intronic
1167580789 19:50341015-50341037 TTTGAGTAATAATAAAACTCTGG + Intronic
1167818357 19:51904287-51904309 TTTGAGTAATAATAAAACTCCGG + Intronic
1168227360 19:55005392-55005414 TTTGAATAATAATAAAACTCTGG - Intergenic
1168455177 19:56501663-56501685 TTTGAAAAATAAGAAAACTGAGG + Intergenic
926239278 2:11072571-11072593 TTTGAGTTATAATGAAACTCTGG - Intergenic
926499670 2:13638193-13638215 CTTGAGTAATAACAAAATCCTGG - Intergenic
926720230 2:15954650-15954672 TTTGAGTAATAAGAAAGCTCTGG + Intergenic
926905536 2:17801869-17801891 TTTGAGTGATAATAAAACTCTGG + Intergenic
928972667 2:37047410-37047432 TTTGAGAAATAATAACACAAAGG - Intronic
929111981 2:38412594-38412616 TTTGAGTAATAATAAAACTCTGG + Intergenic
929321087 2:40544321-40544343 TTTGAGTAACAATAAAACTCCGG - Intronic
929353576 2:40991376-40991398 TTTGAATAATAATAAAACTCTGG + Intergenic
929550862 2:42890869-42890891 TTTGAGGAATAATGAAACTCTGG + Intergenic
929851117 2:45591420-45591442 TTTGAGTAATACTAAAACTCTGG + Intronic
930323040 2:49879483-49879505 CTTGAGTAATAATATAGCTATGG + Intergenic
930707072 2:54515299-54515321 TTTAAGTAATAGCAAAACTCTGG + Intronic
930755079 2:54965510-54965532 TTTGAGTAATAATAAAACTCCGG - Intronic
930839305 2:55827457-55827479 TTTGAGTAATAATAAAGCTCTGG - Intergenic
931608274 2:64073829-64073851 TTTGAATAATAATAAAACTCTGG - Intergenic
931685854 2:64792174-64792196 ATTGAGTATAAATAAAACTGGGG - Intergenic
931896918 2:66742705-66742727 TCTGAGTTATATGAAAACTCAGG - Intergenic
931928707 2:67104636-67104658 TCTGAGTAATAATAAAACTTTGG + Intergenic
932482873 2:72058789-72058811 TTTGGGTAATAATGAAATTAGGG - Intergenic
932561077 2:72870227-72870249 TTTGAGTAATAAGAAAACTCTGG + Intergenic
932727815 2:74194592-74194614 TTTGAGTAATAATAAAACTCTGG - Intergenic
932863459 2:75317804-75317826 TTTGAGTAATAATAAAACTTCGG + Intergenic
932908838 2:75784272-75784294 TGTGAATAATAATAAAACTCCGG - Intergenic
933105673 2:78321995-78322017 TTATAATAATGATAAAACTCAGG - Intergenic
933511752 2:83249017-83249039 TTTGAGTAATAATAAAACTCCGG - Intergenic
933550197 2:83766956-83766978 TCTGGGTAATAATAAAATTAAGG + Intergenic
933809548 2:86024489-86024511 ATTGAGTAAGAATAAAACCGAGG - Exonic
933882085 2:86679764-86679786 TTTTTGTAATAATGAAACACTGG - Intronic
934155923 2:89200266-89200288 TTTGAGTAATAATAAAACTCTGG + Intergenic
934182331 2:89636653-89636675 GCTGAGTATTAATAAAACTGTGG - Intergenic
934211401 2:89982497-89982519 TTTGATTAATAATAAAACTCTGG - Intergenic
934292627 2:91710861-91710883 GCTGAGTATTAATAAAACTGTGG - Intergenic
934671091 2:96213379-96213401 TTTGAGTAATGATGAAACTCTGG + Intergenic
934923998 2:98368695-98368717 TTTGAGTAATAATAAAACTCTGG - Intronic
935139275 2:100337753-100337775 TTTGATGAATAATTAAATTCAGG - Intergenic
936108208 2:109643819-109643841 TTTGAGTAATAATAGAACTCTGG + Intergenic
936448442 2:112615391-112615413 TTTGAGTAATAATAAAACTCTGG + Intergenic
936752650 2:115664409-115664431 TGAGAATAATAATAAAATTCAGG - Intronic
936891015 2:117370449-117370471 TTTGAGTTATAATAAAATTCTGG - Intergenic
937544459 2:123000003-123000025 TTTGAGTAATAATGATACTTCGG + Intergenic
937575196 2:123411356-123411378 TTTCAGTAATAATAAAACCCTGG + Intergenic
937726377 2:125172427-125172449 TTTTACAAATAATAAAACTGAGG - Intergenic
937795874 2:126019410-126019432 TTTGAGTAACAATAAAACTCCGG + Intergenic
938700269 2:133871846-133871868 TTTGAGTAATAATAAAACTCTGG - Intergenic
938892672 2:135721546-135721568 TTTGAACAATTAGAAAACTCTGG + Intronic
939134199 2:138274344-138274366 TTTGAGTAATAATAAAATTCTGG - Intergenic
939207659 2:139128375-139128397 TTTGAATAGTAATAAAACTCCGG + Intergenic
939356457 2:141109270-141109292 TTTGATTAATAATAAAACTTTGG + Intronic
939567730 2:143804494-143804516 TGTGAGCAATAATGAAATTCAGG - Intergenic
939631429 2:144530464-144530486 ATTAGGTAATAATATAACTCAGG - Intergenic
939726423 2:145726724-145726746 TTTGAGTAATAATAAAACTCTGG + Intergenic
939726550 2:145727561-145727583 TTTGAGTAATAATAAATCTCCGG + Intergenic
940110471 2:150147139-150147161 TTTGAGTAATAATAAAACTTGGG - Intergenic
940402024 2:153258340-153258362 TTTGAGTAATAGTAAAGCTCTGG + Intergenic
940612769 2:156011245-156011267 TTTGAGTAATAGTAAAACTCTGG - Intergenic
940650065 2:156433575-156433597 TTTGAGTAATAATAAAACTCTGG + Intergenic
940707786 2:157126138-157126160 TTTGAGTAATAATAAAATACTGG + Intergenic
941245086 2:163086093-163086115 TTTGAGTAATAATAAAATTCTGG + Intergenic
941606401 2:167602701-167602723 TTTGAGTCATAACAAACCACAGG - Intergenic
941877354 2:170447742-170447764 TTTGAGTAATAATAAAACTCTGG - Intronic
941960273 2:171246420-171246442 TTTGAGTAATAATAAAACTCTGG - Intergenic
942173500 2:173309362-173309384 TTTGAGTAATAATAAAACTCTGG - Intergenic
942314442 2:174684358-174684380 TTTTAGTAATAATAAAACTCTGG + Intergenic
942626007 2:177901397-177901419 TTTGAGTAATAATAAAACTCCGG + Intronic
942957819 2:181794774-181794796 TTTGACTAACAATTAAACTGAGG - Intergenic
943607025 2:189987925-189987947 ATTGAGTAATAATAAAAATCTGG - Intronic
943759021 2:191588297-191588319 TTTGAGTAATAATAAAACTCTGG + Intergenic
943956693 2:194200684-194200706 TTTGAGTAATGATAAAACTCTGG + Intergenic
944023971 2:195141904-195141926 TTTGAGTGATAATAAAACTCTGG - Intergenic
944028206 2:195197973-195197995 TTTTACAAATAATGAAACTCAGG + Intergenic
944646882 2:201789074-201789096 TTTGAGTAATAATAAAACTCTGG - Intergenic
945172601 2:207012444-207012466 TTTGAGCAATAATAAAACTCTGG - Intergenic
945580644 2:211590681-211590703 TTCGAGTAACGATAAAACTCTGG + Intronic
945936715 2:215909738-215909760 TATGAGTAATAATAAAACTCCGG + Intergenic
946765574 2:223037051-223037073 TTTGAGTAATAATAAAACTCTGG - Intergenic
947045799 2:225982059-225982081 TTTGAGTAATAATAAAACTCTGG - Intergenic
947158013 2:227183320-227183342 TATGAGTTAGAATAAAACTAAGG + Intronic
947216308 2:227753295-227753317 TTTGGGTAGTAATAAAACTCCGG + Intergenic
947226299 2:227843597-227843619 ACTTAGTAATAATAAAACTCTGG + Intergenic
947519158 2:230830459-230830481 TTTGAGTAATAATACAACTCTGG - Intergenic
947520034 2:230838487-230838509 TTTGAGTAATGATAAAACTCTGG + Intergenic
947614492 2:231546478-231546500 TTTGTGAAAGAATAAAATTCCGG - Intergenic
947802686 2:232941004-232941026 TTTGAGTAGTAATAAAACTCTGG - Intronic
947895046 2:233663274-233663296 TTTGAGTAATAATAAAACTCCGG - Intronic
947950812 2:234145591-234145613 TTTGAGTAATAATAAAACTCTGG + Intergenic
948006701 2:234615410-234615432 TTTGAGTAATAATAAAACTCTGG + Intergenic
948032221 2:234828306-234828328 TTTGGGTAATAATACAACTCTGG - Intergenic
948302368 2:236917371-236917393 TTTGAGTAACAACACAACTCTGG - Intergenic
1168941793 20:1719016-1719038 TTTGAGTAATAATAAATCTCTGG - Intergenic
1169324767 20:4666302-4666324 TTTGAGAAATGATAAAACTCGGG + Intergenic
1169651886 20:7878166-7878188 TTTGAGTAATAATAAAGCTCTGG - Intergenic
1169854560 20:10089046-10089068 CTTGAGTAGTAATAAAACTCTGG + Intergenic
1169881003 20:10346547-10346569 GTTGACTAGTAATAAAATTCAGG + Intergenic
1169952048 20:11055683-11055705 TTTGAATGATAATAAAAATAAGG - Intergenic
1170114970 20:12847692-12847714 TTGGAGAAATACAAAAACTCTGG + Intergenic
1170229660 20:14030695-14030717 TTTGATTAAAAATAAAATTCTGG - Intronic
1170466018 20:16623149-16623171 TTTGAGTAATGACAAAATTCTGG - Intergenic
1170936186 20:20811812-20811834 TTTGAGTAATAATAAAATTCTGG - Intergenic
1171097905 20:22349955-22349977 TTGGAGAAATAAAAAGACTCTGG + Intergenic
1171559980 20:26115477-26115499 ATTAGGTAATAATAGAACTCTGG - Intergenic
1171942665 20:31346960-31346982 TTTGAGTAATAAAAAAAATCTGG + Intergenic
1172585396 20:36079996-36080018 TTTGAGTAATTATAAAACTCTGG - Intergenic
1172795819 20:37536614-37536636 TTTGAGTAATAATAAAACTCCGG + Intergenic
1172821173 20:37735782-37735804 TTTGAGTACTTATAAAATTATGG + Intronic
1173340314 20:42147443-42147465 GTTGAGTAAAGAAAAAACTCTGG - Intronic
1173514668 20:43657051-43657073 TTTGAGTAATAATACAACTCTGG + Intergenic
1173600880 20:44294342-44294364 TTTGAGTAATAATAAAACTCCGG - Intergenic
1173632679 20:44528468-44528490 TTTGAGCAATAATAAAGCTCCGG + Intergenic
1173632808 20:44529412-44529434 TTTGAGTAATAACAAAACTCTGG - Intergenic
1174217446 20:48927830-48927852 TTTGAGAAATAACAGGACTCAGG + Intronic
1174537120 20:51259858-51259880 TTTGAGTAATAACAAGGCTCTGG + Intergenic
1174552379 20:51371359-51371381 TTTGAGTAATAATGAAACTCCGG - Intergenic
1174754453 20:53143878-53143900 TTTGAATAACAATAAAACTCCGG - Intronic
1174836043 20:53856046-53856068 TTTGAGTAACAACAAAACTCTGG - Intergenic
1175071222 20:56335553-56335575 CTTGAGTAATAATTAAACCCTGG - Intergenic
1176651061 21:9547369-9547391 ATTAGGTAATAATAGAACTCCGG + Intergenic
1177260377 21:18722084-18722106 TTTCAGTAGTAATAAAACTGTGG + Intergenic
1177289742 21:19095968-19095990 TTTGAGTATTATTAAAATGCTGG + Intergenic
1177402991 21:20630664-20630686 TTTGAGTCATAATAAAACTCTGG - Intergenic
1177420550 21:20851657-20851679 TTTGAGTAATAGTAAAACTCTGG - Intergenic
1177510540 21:22081471-22081493 ATTGTGTAAAAACAAAACTCTGG - Intergenic
1177549493 21:22601478-22601500 TATGAGTAATAATAAAACTTCGG + Intergenic
1177563477 21:22786959-22786981 TTTGAGTAAAAAAAAATCCCTGG - Intergenic
1177737317 21:25107821-25107843 TTTGAGTAATAATAAAGCTCTGG - Intergenic
1178097448 21:29231496-29231518 TTTGAGTAATAATGAAACTCTGG - Intronic
1178231830 21:30794569-30794591 TTTGAGTCAAAAAATAACTCAGG + Intergenic
1178382450 21:32122106-32122128 TTTGAGTAATAATAAAACTCCGG + Intergenic
1178602703 21:34008724-34008746 TTTGAGTAATAATAAAACTCTGG - Intergenic
1178785574 21:35650141-35650163 TTTGAGTAATAATAAAACTCTGG + Intronic
1179234789 21:39536116-39536138 TTTGAGTAATAATAAAGCTCTGG - Intergenic
1179239811 21:39580107-39580129 TTTAAGTAATCATAAAACTCCGG + Intronic
1179640139 21:42742308-42742330 TTTGAGGAATAATAAAACTCTGG - Intronic
1179672662 21:42960693-42960715 TCCGAGTAATAATAAAACTCTGG - Intergenic
1180106181 21:45619557-45619579 TTTGAGCAATAATGAATCTCGGG - Intergenic
1181461315 22:23087584-23087606 TTTGAGTAATAATAACACTCCGG - Intronic
1181503613 22:23335459-23335481 TTTGAGCAATAATAAAACTCCGG - Intergenic
1181708608 22:24665693-24665715 TTTGAGCAATAATAAAACTCCGG - Intergenic
1181737906 22:24896267-24896289 TTGGAGTAAAAAAAAAACTCTGG + Intronic
1182335679 22:29581819-29581841 TTTGAGTAATAATAAAACTCCGG - Intergenic
1182488181 22:30652060-30652082 TTTCAGTAATAGTAAAACTCTGG - Intronic
1182559717 22:31150255-31150277 TTTGAGTAACAATAAAACTCGGG + Intergenic
1183401260 22:37606234-37606256 TTTCAGTAATAATTCATCTCAGG + Intergenic
1183872657 22:40752174-40752196 TTTAAGTAATAATAAAACTCTGG + Intergenic
1184904617 22:47472626-47472648 TTTGAGTAATAATAAAACTCCGG + Intronic
1184960772 22:47926897-47926919 TTTGAGTAATAATACAACCCTGG - Intergenic
1185405121 22:50643359-50643381 TTTGAGTAATAATAAAACTCTGG - Intergenic
949638869 3:6013296-6013318 TTTCAGTAATAATAGAAATATGG - Intergenic
949789941 3:7781869-7781891 TTTGAGTAATAATAAAACTCCGG - Intergenic
949993561 3:9599379-9599401 TTTGAGTAATAATAAAACTCTGG - Intergenic
949997558 3:9630485-9630507 TTTGAGTAATAATAAAATTCTGG - Intergenic
950314595 3:11989443-11989465 TTTTAATAATAGTAAAATTCAGG - Intergenic
950439178 3:12998633-12998655 TTTAAATAAAAATAAAAATCTGG + Intronic
950511835 3:13433947-13433969 TTTGAGTAATAATAGAACGCCGG + Intergenic
950780557 3:15388035-15388057 TTTGAGTAATCATAAAACTCTGG - Intronic
950935779 3:16837554-16837576 TTTGAGTAATAATAAAACTCCGG + Intronic
950946460 3:16953759-16953781 TTTGATTAAAAAAAAAACTATGG - Intronic
951113449 3:18832801-18832823 TTTGAGTAGTAATAAAAATCTGG - Intergenic
951263497 3:20540016-20540038 TTTGAATAATAATAAAACTCTGG - Intergenic
951279455 3:20730933-20730955 AATGAGCAATAATAAAAATCTGG - Intergenic
951485627 3:23205883-23205905 TTTAAGTAATTATATAACTATGG + Intronic
951902617 3:27671945-27671967 TTTGAAAATTAATAAAATTCAGG + Intergenic
952108523 3:30096123-30096145 TTTGAATAATAATAAAAGTCTGG - Intergenic
952112960 3:30145628-30145650 TATGAGTAATAGGAAGACTCTGG + Intergenic
952194710 3:31062473-31062495 TTTGAGTAATAATAAAAATCTGG + Intergenic
952427938 3:33194282-33194304 TTTGAGTAATAATAAAACTCTGG + Intronic
952734379 3:36674344-36674366 TTTGAGTAATAATAAAACTCTGG - Intergenic
952767300 3:36965434-36965456 TTTGAGTAATAATAAAACTCCGG - Intergenic
952928861 3:38344253-38344275 TTTGAGTAATAATAAAACTCTGG - Intergenic
953437695 3:42892179-42892201 TTTGAGTAATAACAAAACTCTGG - Intronic
953745611 3:45571637-45571659 TTTGAGTAATAATAAAACTCTGG + Intronic
954060729 3:48064497-48064519 TTTAAGTAATAATAAAACTCTGG + Intronic
954085138 3:48238554-48238576 TTTGAGTAATAATAAAACTCTGG - Intergenic
954592645 3:51796866-51796888 TTTGAGTAATAATAAAACTCAGG - Intergenic
954775409 3:53012725-53012747 TTTTAGTAATAGGAAAACACTGG + Intronic
955655687 3:61242633-61242655 TCTCAGTAATAATAAAACTCTGG - Intronic
956026367 3:64987185-64987207 TTTGAGTAATAATAAAACTCTGG + Intergenic
956240369 3:67123340-67123362 GTTGAGTAATAATTAAAAGCTGG - Intergenic
956245652 3:67180007-67180029 TTTGAGTAATGAGAGAACTGAGG - Intergenic
956351412 3:68341159-68341181 TTTGAGTATTAATAAAACTATGG - Intronic
956706702 3:72005293-72005315 TATGAGTAATAATAAAACTCTGG + Intergenic
956960589 3:74395594-74395616 TTTCAGAGATAAGAAAACTCAGG - Intronic
957704652 3:83764677-83764699 TTTGAGCCCTAATAAAACTTTGG + Intergenic
958573147 3:95912615-95912637 TTTGAGTACTAATAAAACTCTGG - Intergenic
958862872 3:99466404-99466426 TATGATAAATAATACAACTCAGG + Intergenic
959033855 3:101336816-101336838 TTTGGTTAATACTAAAACTGTGG - Intronic
959157370 3:102682971-102682993 TTTGAGGAATAATAAAACTCTGG + Intergenic
959158376 3:102694455-102694477 TTTGAGTAATAATAAAGCTCTGG + Intergenic
959161984 3:102734936-102734958 TTTGAGTAATAATAATACTCTGG + Intergenic
959294536 3:104519256-104519278 TTTGAGTAATAATGAAACTCTGG + Intergenic
959453669 3:106533758-106533780 TTTGAGTAATAATTGAACTCTGG + Intergenic
959454962 3:106548043-106548065 TTTGAGTAGTAATACAACTCTGG + Intergenic
960004727 3:112770366-112770388 TTTGAGTAATAATAAAACTCTGG + Intronic
960609576 3:119543134-119543156 TTTGAGTAATGATAAAACTCCGG + Intronic
960877326 3:122309955-122309977 TTTGAGTAATAATAAAATCGTGG + Intergenic
961942696 3:130654783-130654805 TTTGAGTAATAATAAGACCCCGG - Intronic
962336242 3:134533833-134533855 TTTAAGTAATAATAATATACTGG - Intronic
962450692 3:135514045-135514067 TTTGAGTAATAATAAAACTCTGG + Intergenic
962472821 3:135728358-135728380 TTTGAGTAATAATAAAACTCTGG - Intergenic
962737410 3:138338340-138338362 ATTGAGTAAAAACAACACTCCGG + Intergenic
963103874 3:141629092-141629114 TTTCAGTAATAATAAAACTCTGG - Intergenic
963171628 3:142257030-142257052 TTTGAGTAATAATAAAACTCCGG - Intergenic
963314260 3:143742327-143742349 TCTGAGTAATAATAAAACTCCGG + Intronic
963673602 3:148281208-148281230 TTTTAGTAAATATAAAGCTCAGG + Intergenic
963717711 3:148822566-148822588 TTTGAGTAATAGTAAAACTCTGG - Intronic
963751168 3:149181326-149181348 TTTGAGAAGTAATGAAATTCAGG - Intronic
963993124 3:151676515-151676537 TTTGAGTAATAATAAAACTCCGG + Intergenic
964357394 3:155863163-155863185 TTTGAGCAGTAATAAAACTCTGG + Intergenic
964366198 3:155953283-155953305 TTTGAGTAATAAAAAACCTCTGG - Intergenic
964866573 3:161268984-161269006 TTTGAGTAATAATAAAACTCTGG + Intergenic
964899203 3:161637566-161637588 TTTGAGTAATAATAAAACTCTGG - Intergenic
964921109 3:161896701-161896723 TTTGAGTAATAATAAAACTCAGG + Intergenic
964921246 3:161898207-161898229 TTTGAGTAATAATAAAATTCTGG + Intergenic
965005963 3:163024033-163024055 TTTGAGAAATAAAATAAATCTGG + Intergenic
965069436 3:163899424-163899446 TTTGAATAATAAAAACACTTTGG - Intergenic
965605117 3:170490784-170490806 TTTAAGTAAGAATGAAACTTAGG - Intronic
965763384 3:172105113-172105135 TTTTGCTAATAATAAAACTTAGG + Intronic
965805619 3:172538467-172538489 TGTGAGAAATAATAAAACTCTGG + Intergenic
966065880 3:175821178-175821200 TTTGAATAATAAAAAACCTTAGG - Intergenic
966110937 3:176400679-176400701 TTTGAGGAAAAATAAAAGTTGGG - Intergenic
966533868 3:181009382-181009404 TTTGAGTAATAATGAAACTCTGG - Intergenic
966935689 3:184707226-184707248 TTTGAGTAATAATAAAACTCTGG - Intergenic
967915483 3:194575214-194575236 TTTGAGTAATAATACAGCTTCGG - Intergenic
968019964 3:195376810-195376832 TTTGTGTAAGGATAAAAGTCTGG - Intronic
968120741 3:196124056-196124078 TTTGAGTAATAATAAAACTCCGG + Intergenic
968124093 3:196145769-196145791 TTTGAGTAATAATAAAACTCTGG - Intergenic
968146474 3:196303282-196303304 TTTGAGTAATAATAAAACTCCGG + Intronic
968151889 3:196343518-196343540 TTTGAGTAATAATAAAACTGCGG - Intergenic
968184474 3:196622686-196622708 TTTGAATATAAATAAAACTTAGG + Intergenic
968291019 3:197539867-197539889 TTTGAGTAATAATAAAACTCTGG + Intronic
968928615 4:3563385-3563407 TTTGAGTAATAATAAAACTCTGG + Intergenic
969367438 4:6705672-6705694 TTTCAGAAAAAACAAAACTCTGG + Intergenic
969655246 4:8493484-8493506 TTTGAATAATAATAAAACTCCGG + Intronic
970019611 4:11552999-11553021 TTTGAGTCATCATAATACTGGGG - Intergenic
970452404 4:16183411-16183433 TTTGAGTTTTAAGAAAACTCTGG - Intronic
970528902 4:16962300-16962322 TTTGAGTAATTGTAAAACTTTGG - Intergenic
970592669 4:17572943-17572965 CTTGAGTAATAATAAAACTGTGG + Intergenic
970650012 4:18167272-18167294 TTTGAGTAATAATGAAACTCTGG + Intergenic
970722938 4:19009224-19009246 TTTGAGTAATAATAAAACTCTGG - Intergenic
970729583 4:19087675-19087697 TTTGATTAATAGTAAAACTCTGG - Intergenic
970869271 4:20796529-20796551 CTTGTTTAATAATAACACTCTGG + Intronic
970875397 4:20863143-20863165 TTTGAGTAACAATAAAACTCGGG - Intronic
970877274 4:20885564-20885586 TTTGAGGAATAATAAAACTCCGG + Intronic
971039052 4:22730439-22730461 TTTGAATATTTAAAAAACTCTGG + Intergenic
971132698 4:23830782-23830804 TCTTAGAACTAATAAAACTCTGG + Intronic
971238389 4:24864587-24864609 TTTGAGTGATAAAAAAACTCCGG + Intronic
971322721 4:25618277-25618299 TTTGAGTAATAATAAGACTCTGG + Intergenic
971473798 4:27053770-27053792 TTTGATTCAAAATAAAATTCAGG + Intergenic
971684206 4:29743749-29743771 TAAGAATAATAATAAAACTATGG - Intergenic
971778665 4:31002210-31002232 TTTGAGTAAAAATGTAATTCTGG + Intronic
971822350 4:31574416-31574438 TTTCAGTAATTAGAAACCTCTGG - Intergenic
971893934 4:32565051-32565073 TTAGAGTATTAATATAACACAGG + Intergenic
971941254 4:33218512-33218534 TTTGAGTAATACTAAGACTCTGG + Intergenic
972568660 4:40291192-40291214 TTTGAATAATAATAAAACTCTGG + Intergenic
972743821 4:41913844-41913866 TTTGAGTGATGATAAAACTCTGG + Intergenic
972942608 4:44215162-44215184 TTTGAGCAATAATAAAACTCTGG + Intronic
973190428 4:47378784-47378806 TTTAATTAAAAAAAAAACTCCGG - Intronic
973693039 4:53459777-53459799 TTTGATTAACAAAAAAACTGTGG - Intronic
973796972 4:54437330-54437352 TCTGAGTACTAATAAAATTAGGG - Intergenic
974226145 4:59047955-59047977 TTTGAGAAATAATAAAAAATGGG - Intergenic
974292983 4:59958079-59958101 TATCAGTAATAATAAAACATAGG + Intergenic
974427654 4:61760880-61760902 TCTGAGTAATAATAAAACTCTGG - Intronic
974703992 4:65487778-65487800 TTTGAGTAATAATAAAACTCTGG + Intronic
974818034 4:67031378-67031400 TTTGAGAAATGAAAAAACTGAGG - Intergenic
975293541 4:72705657-72705679 CTTGAGTAATAATAAAACTCCGG + Intergenic
975953391 4:79803762-79803784 TTTTGGTAATAATAATATTCTGG - Intergenic
976008084 4:80454789-80454811 TTTGAGTAACAATAAAACTCTGG - Intronic
976256478 4:83105772-83105794 ATTGGGTAATAATAATACTAGGG + Intronic
976278886 4:83307150-83307172 TTTGAGTAATAATAAAACTCTGG + Intronic
976399205 4:84588502-84588524 TGTGAGTAATAATAAAACCCTGG - Intronic
976417126 4:84790026-84790048 TTTGAGTAATAATACAACTCTGG + Intronic
976443148 4:85100045-85100067 TTTTAAAAATAAGAAAACTCTGG - Intergenic
976649678 4:87421638-87421660 TTTGAGTAATAATAGAACTCCGG - Intergenic
976839112 4:89410515-89410537 TTTGAGTAATGGAAAAATTCAGG + Intergenic
976948223 4:90796723-90796745 TTTGGTAAATAATAAAATTCAGG - Intronic
977073429 4:92422435-92422457 TTTGAGTAATAATAAAACTCTGG - Intronic
977389004 4:96383960-96383982 TTTGAGTACTAATAAAACTCTGG - Intergenic
977509988 4:97951225-97951247 TTTGAGTAATAATAAAACTCTGG + Intronic
977524786 4:98130481-98130503 TTTGATAAAAAATAAAATTCTGG - Intronic
977645903 4:99411204-99411226 TTTGAGTCATCAGAAAACACTGG - Intergenic
977895991 4:102365838-102365860 TTTTTGCAAGAATAAAACTCAGG + Intronic
977926289 4:102704150-102704172 TTTGAGTAATAATAAAACTCTGG + Intronic
977945926 4:102914011-102914033 TTTTAGTAATAATAAAACTCTGG - Intronic
978040586 4:104056377-104056399 TTTTAGTAATAAGGAAACTGAGG + Intergenic
978419253 4:108512518-108512540 TTTGAGTAATGTTAATACTTAGG - Intergenic
978457352 4:108908728-108908750 TTTGAGTAATAATAAAACTCTGG - Intronic
978511280 4:109521685-109521707 TTTCATTAATAATAAAATACTGG + Intronic
978557524 4:109997020-109997042 TTTGAGTAATAATAAGACGATGG - Intronic
978783464 4:112581719-112581741 TTTGGTTCATTATAAAACTCAGG + Exonic
978882115 4:113718220-113718242 TTTGAGTAATAATAAAACTCTGG - Intronic
979054096 4:115975286-115975308 TTTGAGTAATAATAAAACTCCGG - Intergenic
979308122 4:119172310-119172332 TTTCAGTAATAATAAAACTCTGG - Intronic
979484684 4:121257167-121257189 TTTGAGAAATAATAAAACTCCGG - Intergenic
979591264 4:122483143-122483165 TTTGAGTAATAATATAACTCTGG - Intergenic
979898896 4:126192861-126192883 TTTGAGTGATAATAAAACTCTGG + Intergenic
980121439 4:128732137-128732159 CTTGCATAATAATAAAACTCTGG - Intergenic
980222079 4:129930372-129930394 TTTGAGTAATAATAAAACTCCGG + Intergenic
980322071 4:131291636-131291658 TTTGAGTAATAATAAATCTCCGG - Intergenic
980466716 4:133196221-133196243 TTTGAGTAATAATAAAACTCTGG - Intronic
980489165 4:133503872-133503894 CATGAGTAATAATAAAACTCTGG - Intergenic
980497117 4:133600328-133600350 TTTGAGTGGTAATAAAATTCTGG + Intergenic
980673525 4:136043412-136043434 TTTAAATAATAATAAAAATGAGG - Intergenic
980777176 4:137452369-137452391 TTTGAGTAATAATAAAACTCTGG - Intergenic
980777432 4:137454521-137454543 TTTGAGTAGTAATAAAACTCCGG + Intergenic
981042892 4:140239117-140239139 TTTCAGTATTAAAAAATCTCGGG + Intergenic
981258274 4:142689083-142689105 TTTAAGTAATAATAAAACTCTGG + Intronic
982170025 4:152652900-152652922 TATGAGGAATTAGAAAACTCAGG - Exonic
982237766 4:153267922-153267944 TTTGAGTAATAATAAAACTCTGG - Intronic
982378466 4:154721761-154721783 ATTGAGTAATAATATAAAACTGG + Intronic
982474709 4:155835528-155835550 ATTAAGTAATTATGAAACTCAGG + Intronic
982868313 4:160545447-160545469 TTTGTGTAGAAATAAAACTCTGG - Intergenic
982904457 4:161050047-161050069 TTTGAGTAATAATAAAACTATGG + Intergenic
983169010 4:164514692-164514714 TTTGAATTAAATTAAAACTCTGG + Intergenic
983170690 4:164532708-164532730 TATAAGTAATAATAAGAGTCTGG - Intergenic
983406279 4:167335181-167335203 TTTGAATCATAATAAAAGTCTGG + Intergenic
983463790 4:168060554-168060576 TAAAAGTAATAATAAAAATCAGG - Intergenic
983496727 4:168450442-168450464 ATTGAATAATAATAAAACTCTGG + Intronic
983660113 4:170122655-170122677 TTCGAGTAATAATAAAATTCTGG + Intergenic
983748866 4:171238136-171238158 TTCAAATAAAAATAAAACTCTGG - Intergenic
983966364 4:173817147-173817169 TTTGGGTAATAAAAATATTCTGG + Intergenic
984003148 4:174275343-174275365 ACTGAGTAAAAATAAAACTAGGG + Intronic
984090390 4:175366881-175366903 TCTGAGTAAAAATAAAACCAAGG + Intergenic
984097836 4:175453534-175453556 TTTGAGTAATAATGAAACTCTGG - Intergenic
984099827 4:175472145-175472167 TTTGAGTAATAATAAAACTCCGG - Intergenic
984902812 4:184600107-184600129 TTTGAGTAATAATAAAACTCTGG + Intergenic
985154887 4:186976905-186976927 ATTTAGTAATGATAAAACTGAGG + Intergenic
985339550 4:188934607-188934629 TTTGAGTAATAATGAAACTCTGG + Intergenic
985384485 4:189431037-189431059 TTTGAGTAATAAGAAAGCCTTGG + Intergenic
985653491 5:1118121-1118143 TTTCAGTAATAATAAAACTCCGG + Intergenic
985653503 5:1118200-1118222 TTTGAGTGACAGTAAAACTCCGG + Intergenic
986194100 5:5522094-5522116 TTTGAGTAATAATAAAACTTCGG - Intergenic
986242861 5:5977061-5977083 TTTGAGTTATTATAGAAGTCAGG + Intergenic
986664617 5:10089854-10089876 TGTGGGAAATTATAAAACTCAGG + Intergenic
986877710 5:12131721-12131743 TTTCTGTAAACATAAAACTCAGG + Intergenic
987125243 5:14806060-14806082 ATGGAGCAATAATACAACTCAGG + Intronic
987334564 5:16887482-16887504 TAATAATAATAATAAAACTCAGG - Intronic
987395378 5:17418169-17418191 TTTGAGTAATCATAAAACTCTGG + Intergenic
987548006 5:19338952-19338974 TTTGAGTAATAACACAACTCTGG - Intergenic
987852106 5:23369259-23369281 TATAACTAATAATAAACCTCAGG - Intergenic
988130411 5:27096874-27096896 TTTGAGTAATAATAAAACTATGG - Intronic
988377650 5:30457785-30457807 TTTGAATAAGAATAAAACCATGG + Intergenic
988458524 5:31410851-31410873 TTTGGTGAATAATAGAACTCAGG - Exonic
988776342 5:34481012-34481034 TTTGAGTAATAACAAAACTCTGG + Intergenic
989388842 5:40879895-40879917 TTTGAGTAATAATAAAACTCTGG - Intergenic
989412836 5:41140246-41140268 TTTGAGTAATAATAAAACTCAGG - Intergenic
989579785 5:43021310-43021332 TTTGAGTAATAATAAAATTCAGG - Intergenic
989976038 5:50588429-50588451 TTTGAGTAAAAATAAATCTCGGG - Intergenic
990208836 5:53459220-53459242 TTTGAGTAATAATAAAACTCTGG + Intergenic
990563360 5:57005377-57005399 ATTGAGTACCAATAAAACTATGG + Intergenic
990744357 5:58943632-58943654 TTTGGGTAATAATAAAACTCTGG - Intergenic
990827003 5:59911517-59911539 TTTGAGTAATAATAAGACTCTGG + Intronic
991030411 5:62076551-62076573 TTTGAGTAATGATAGAACTCTGG + Intergenic
991207687 5:64068059-64068081 TCTGACTAATAACAAAACTCCGG + Intergenic
991239930 5:64445822-64445844 TTTGAGTAATAATAAAATTCTGG + Intergenic
991670747 5:69045210-69045232 TTTGAGTAATAATAAAACTCTGG - Intergenic
991951212 5:71948301-71948323 TTTGAGTAATAATAAAATTCTGG - Intergenic
992107412 5:73461378-73461400 TTTAAGTAATAATAAAACTCTGG + Intergenic
992539660 5:77751764-77751786 TTTGAGTAATAATAAAACTCTGG - Intronic
992722916 5:79578345-79578367 TTTGAGTAACAATAAAACTCTGG + Intergenic
992761397 5:79953842-79953864 TTTGAGTAATAATAAAATTCCGG + Intergenic
992771221 5:80050264-80050286 TTTGAGTAATAATAAAACTCTGG - Intronic
993272879 5:85817536-85817558 TTTGAGTAATAATAAAACTCTGG + Intergenic
993404181 5:87490432-87490454 TTTGAGTAAGAAGAAAAAGCTGG - Intergenic
993648023 5:90483196-90483218 TTTAAGGAATAATAAAACTCCGG + Intronic
993833873 5:92792373-92792395 TTTGGGTAATAATGAAATTAAGG - Intergenic
994034668 5:95185000-95185022 TTTGAGTAATGATAAAACTCCGG + Intronic
994079736 5:95695185-95695207 TATGAATAATAATAAAAGTAAGG + Intronic
994149080 5:96427666-96427688 TTTGAGTAAGAATAACAGTTAGG + Intronic
994521678 5:100846082-100846104 TTTGATTAATAATAAATTGCAGG + Intronic
994648405 5:102498186-102498208 TTTGAGCAATAAAAAAACTCTGG + Intronic
994778329 5:104062842-104062864 TTTGAGTAATAATAAAACTCTGG + Intergenic
994979401 5:106854457-106854479 TTTGAGGCAAAATAAATCTCTGG - Intergenic
995620185 5:114017401-114017423 TTTGAGTAATAATAAAACTCTGG + Intergenic
995834022 5:116382747-116382769 TTTGAGTAAATATCAAACTTAGG - Intronic
995942857 5:117605959-117605981 TTTTATTGATAATAAAACTCAGG - Intergenic
996132528 5:119798820-119798842 TTTGAGTAATAATAAAACTCCGG + Intergenic
996832604 5:127756320-127756342 TTTGAGTAATAATAAAATCCCGG - Intergenic
997301488 5:132809289-132809311 TTTGAGTAATAATAAAACTCTGG + Intergenic
997554432 5:134783137-134783159 TTAGAGTAAAAATGTAACTCAGG - Intronic
997960952 5:138321242-138321264 TTTGAATAATGAAAAAATTCTGG + Intronic
998023956 5:138797172-138797194 TGTGTATGATAATAAAACTCAGG - Intronic
998093857 5:139386172-139386194 TTTGAGTAATAGTAAAACGCTGG + Intergenic
998744904 5:145247302-145247324 TTTGAGTAATAATAAAACTCCGG + Intergenic
999405300 5:151301637-151301659 TTTGAGTGATAATAAAACTCCGG + Intronic
999583467 5:153064942-153064964 TTTTAGTAATAATAAAACTCTGG - Intergenic
1000089487 5:157917913-157917935 TTTGAGTAATAATAAAACTCTGG - Intergenic
1000089788 5:157920522-157920544 TTAGAATAATAATAAAACCTTGG - Intergenic
1000227795 5:159284047-159284069 TTTGTGTAATAATAACACTTTGG + Intronic
1000718600 5:164678646-164678668 TTTGAGTAATAATAGAACTCAGG - Intergenic
1000997010 5:167969610-167969632 TTCAAGTAATACTTAAACTCAGG + Intronic
1001909279 5:175501921-175501943 TTTGAATAATAATAAAACTCCGG - Intronic
1001922540 5:175611752-175611774 TTTGAGTAATAAGAAAACTCTGG - Intergenic
1002379419 5:178815339-178815361 TTTGAGTAATGATCAAACCAAGG - Intergenic
1002929933 6:1626295-1626317 TTTTAGTACTATTAACACTCTGG - Intronic
1003255950 6:4475052-4475074 TTTGAGTAATAACAAAACTCTGG - Intergenic
1003267977 6:4583268-4583290 TTTGAGTAATCATAAAACTCTGG + Intergenic
1003312349 6:4980656-4980678 TTTGAGTAATAATAAAACTCTGG - Intergenic
1003485364 6:6571459-6571481 TTGGGGTGATAATAAAATTCTGG - Intergenic
1003877295 6:10450095-10450117 TTTAAGTAATCATCAAACTCCGG + Intergenic
1004257638 6:14079605-14079627 TTTGAGTATTTATAAAACTCTGG + Intergenic
1004289122 6:14350536-14350558 TTTGAGAAATAACAAAGCTCTGG + Intergenic
1004359101 6:14955123-14955145 TTCGAGTAATAATAGAACTCCGG + Intergenic
1004445523 6:15694050-15694072 TTTGAGTAATAATAAAACTCCGG + Intergenic
1004468436 6:15906965-15906987 TTTGAGTAATAATAAAATTCTGG - Intergenic
1004659788 6:17700154-17700176 TTTGAGTAATAATAAAACTGTGG + Intronic
1004680839 6:17892843-17892865 TTTGATAAAGGATAAAACTCAGG - Intronic
1005034734 6:21545237-21545259 TCTGAATAATAATAAAACTCTGG - Intergenic
1005233716 6:23735294-23735316 ATTGAGTAATAGTGAAACTCAGG + Intergenic
1005317240 6:24615200-24615222 TATGAATAATAATAAAAGACTGG + Intronic
1005335809 6:24794972-24794994 TTTGAGTAATAACAAAACTCTGG + Intergenic
1005335944 6:24796523-24796545 TTTGAGTAATAACAAAACTCTGG - Intergenic
1005482649 6:26269211-26269233 TTTGAGTAACAATAAAACTACGG + Intergenic
1005661767 6:28005385-28005407 TTTGAGTAACAATAAAACAACGG + Intergenic
1007276866 6:40680445-40680467 TTTGAGTAATAATATAATTCTGG + Intergenic
1007539374 6:42627047-42627069 TTTGAGTAATAATAAAGCTTTGG - Intronic
1007660252 6:43480062-43480084 TTTGATTGATAAGAAAACTGAGG - Intronic
1008440721 6:51529269-51529291 TTTGAGTAATAATAAAACTCTGG - Intergenic
1008672965 6:53792502-53792524 TTTGAGATATGATAAAACTGAGG + Intergenic
1008695084 6:54026290-54026312 TATGAGTAATTAAAAAATTCTGG + Intronic
1008939585 6:57031764-57031786 TTTGAACAATAATTAAACTCTGG + Intergenic
1009317229 6:62235448-62235470 TCTCTGTAATAATTAAACTCAGG - Intronic
1009466499 6:63977030-63977052 CTTGAGTAATAATAAAACTCTGG - Intronic
1009481213 6:64159983-64160005 TTTTACAAATAATAAAACTGAGG + Intronic
1009583790 6:65569836-65569858 TTTGAGTAATAATAAAACTCAGG + Intronic
1009716535 6:67405208-67405230 TTTAAGTAATACTAAAACTCTGG + Intergenic
1009750883 6:67878328-67878350 TTTGAGTAATAATAAAACTCTGG - Intergenic
1010201116 6:73282888-73282910 TTTGAGTAATGATAAAACTCTGG + Intronic
1010574582 6:77515067-77515089 TTTGAGTAATAATAAAATTCTGG + Intergenic
1010831593 6:80537422-80537444 ATTGAGTAATAGCAATACTCAGG - Intergenic
1011091613 6:83608695-83608717 TTTGAGGAAAAAAAAAACTGAGG + Intronic
1011367245 6:86596566-86596588 TTTTACTAATAATAAAAGTAAGG + Intergenic
1012201288 6:96409425-96409447 TTTGAGTAATAACAAAACTCTGG + Intergenic
1012378906 6:98596362-98596384 TTTGAGAAATAATAAAAGTAAGG + Intergenic
1012960653 6:105618187-105618209 TTTGAGAAGAAAGAAAACTCTGG - Intergenic
1013246060 6:108288670-108288692 TTTGAGTAGTAATAAAACTCTGG - Intergenic
1013478396 6:110530689-110530711 TTTGAGTAATAATAAAACTTTGG - Intergenic
1013532599 6:111033913-111033935 TTTGGGTAATAATAAAACTCTGG - Intergenic
1013730427 6:113157939-113157961 TATGAATAATAAGAAAACTCTGG - Intergenic
1014384347 6:120781799-120781821 TTTAGGTAATCATAAAACTGTGG - Intergenic
1014917984 6:127176733-127176755 TTTAAATAATTATAAAACCCTGG - Intronic
1015367822 6:132416578-132416600 TTTAGGTAATAATAAAACTCTGG + Intergenic
1016707614 6:147130030-147130052 TAAGAGTATTTATAAAACTCTGG - Intergenic
1016727680 6:147394089-147394111 TTTTATAAATAACAAAACTCAGG - Intergenic
1016741618 6:147534510-147534532 CTTGAGTAATAATAAAACTCTGG - Intronic
1017177786 6:151520904-151520926 TTTGAGTAATAAGAAAACTCTGG + Intronic
1017285250 6:152667575-152667597 TTTGAATAACAAGAAAAATCAGG - Intergenic
1017583408 6:155893134-155893156 TTTTAGTAATAGTAAATGTCAGG + Intergenic
1017609910 6:156174374-156174396 TTTGAGTAATAATAAAACTCTGG + Intergenic
1017795909 6:157844253-157844275 TTTGAGTAATAATAAAACTCCGG - Intronic
1017921786 6:158879301-158879323 TTTGAGTAACAATAAAACTCTGG - Intronic
1017980571 6:159397794-159397816 TTTGAGTCATAATAAAACTCTGG + Intergenic
1018189032 6:161292360-161292382 TTTGCATATCAATAAAACTCTGG + Intergenic
1018189717 6:161299683-161299705 TTTGAGTAATAATAAAACTCTGG + Intergenic
1018227408 6:161641557-161641579 ACAGAGTAATAATAAAACTCTGG + Intronic
1018313191 6:162531398-162531420 TTTGAGTAATTATAAAACTCAGG - Intronic
1018802359 6:167233881-167233903 TTTGGGTAATAACACAATTCCGG + Intergenic
1018944040 6:168333342-168333364 TTTGAGAAATAATAAACTTTGGG + Intergenic
1019232224 6:170576966-170576988 TTTGAGAAATACCAAACCTCAGG - Exonic
1020267158 7:6568658-6568680 TTTGAGTAATAATAAAACTCCGG - Intergenic
1020354481 7:7261776-7261798 TTTAAATAATAGTAAAATTCTGG - Intergenic
1020518185 7:9152096-9152118 TTTGAGTAATAACACAACTCTGG + Intergenic
1020579417 7:9976126-9976148 TTTCTGTAATAAGAAAGCTCTGG - Intergenic
1020764007 7:12298734-12298756 TTTGAATAGTAATAAAACTCTGG + Intergenic
1020832650 7:13110953-13110975 TTTGAGTAATAATAAAACTCTGG - Intergenic
1021124560 7:16836446-16836468 TTTGAGCAACAATAAAACTCTGG - Intergenic
1021144538 7:17068706-17068728 TTAGAAAAATAATACAACTCAGG + Intergenic
1021180335 7:17498515-17498537 CAGGAGTAATAATAAAACTCTGG - Intergenic
1021507574 7:21402479-21402501 TTTGAGTAATAATAAAACTCTGG - Intergenic
1021650037 7:22823965-22823987 TTTGAGTAATAATAAAACTCTGG - Intergenic
1021732413 7:23608817-23608839 TTTGAGTAATAATAAAATTCTGG - Intronic
1021894412 7:25220641-25220663 ATTAAGTAATAAGAAAACTCTGG + Intergenic
1022880774 7:34584859-34584881 TTTGAGTAATGATAAAACTTTGG + Intergenic
1023189798 7:37568262-37568284 TTTGAACAATAATAAAACTCTGG - Intergenic
1023411393 7:39892280-39892302 TTTGAGTAGTAATAAAACTCTGG + Intergenic
1023437172 7:40150731-40150753 TTTGAGTAATAATAAAACTCCGG + Intronic
1023753979 7:43398752-43398774 TTTGAGTGATACTAAAACTCTGG - Intronic
1024169333 7:46768080-46768102 TACGAGTAACAATAAAACTCTGG + Intergenic
1024239067 7:47419941-47419963 TTTGGGTAGTAATAAAACTCTGG + Intronic
1024770365 7:52714730-52714752 TTTGAGTAATAATAAAATTCTGG - Intergenic
1024846082 7:53643885-53643907 TGTGAGTAATAATAAAACTCTGG - Intergenic
1024940712 7:54759989-54760011 TCTGAGGAACAATATAACTCAGG + Intergenic
1025277740 7:57598304-57598326 ATTAGGTAATAATAGAACTCCGG + Intergenic
1025624416 7:63207240-63207262 GTTGAGTAATAATAAAATTCTGG - Intergenic
1025717693 7:63977628-63977650 TTTGAGGAATAACAAAGCTGAGG + Intergenic
1026110935 7:67458517-67458539 TTTGAGTAATAGTAAAACTCTGG + Intergenic
1026139226 7:67690788-67690810 TTTGAGTAATAATAAAATTCTGG + Intergenic
1026205764 7:68255849-68255871 TTTGAGTAGTAATAAAGCTCGGG - Intergenic
1026247622 7:68635218-68635240 TTTGAATAATAATAAAACTCTGG - Intergenic
1026288023 7:68980751-68980773 TTTAAGTAATAACAAAACTCTGG + Intergenic
1026494690 7:70892315-70892337 TTTGAGTAATAATAAATCTCCGG + Intergenic
1026495140 7:70895359-70895381 TTTGAGTAATAAGAAAACCCTGG - Intergenic
1026496423 7:70907553-70907575 TTTGAGTAATGATAAAACTCTGG + Intergenic
1026520312 7:71111798-71111820 TTTGAGTAATAATAAAACTCCGG + Intergenic
1026559456 7:71436076-71436098 TTTGAGTAATAATAAAACTCGGG + Intronic
1026695466 7:72587373-72587395 TTTGAGTAATCATAAAACTCCGG - Intronic
1027161283 7:75804342-75804364 TTTGAGTAATAATAAAACTCTGG - Intergenic
1027161609 7:75806690-75806712 TTTGAGTAACAATAACGCTCCGG + Intergenic
1027218485 7:76199344-76199366 TTTGAGTAATAATAAAACTCTGG + Intergenic
1027291985 7:76723968-76723990 TGTCAGTAATAATAAAACCAAGG - Intergenic
1027362417 7:77422860-77422882 TTTGAGTAATAATAAAACTTTGG + Intergenic
1027467695 7:78536048-78536070 TTTGGGTAATAATAAAACTCTGG + Intronic
1027824336 7:83091479-83091501 TTTGAGTAATTCTCAAAATCAGG - Intronic
1027994045 7:85400930-85400952 TTAGAGTAATCATAAAAGACAGG + Intergenic
1028005643 7:85563544-85563566 TTAGATTAATAATAGGACTCAGG + Intergenic
1028329148 7:89566907-89566929 TTTGAGTAAAAAAAAAATTAAGG + Intergenic
1028740420 7:94268273-94268295 TTTGAGTAATAATAAAACTCCGG - Intergenic
1029030408 7:97460815-97460837 TTTCAGTAATAATAAAACATCGG + Intergenic
1029559531 7:101293379-101293401 TTTGAGTAATAATAAAACTCAGG + Intergenic
1029618839 7:101677426-101677448 TTTGAGTAATAATAAAACTCCGG + Intergenic
1029800462 7:102941478-102941500 TTTGAGTAATAATAAAACTCTGG + Intronic
1029930182 7:104362704-104362726 TGTGAGTAATAATAAAACTCTGG - Intronic
1030672613 7:112353563-112353585 TTTGGGTAATGAAAAAATTCTGG + Intergenic
1030999706 7:116400626-116400648 TTTGAGTAATAATAAAACTCTGG - Intronic
1031794684 7:126156845-126156867 GTTGAGTAATCATAAAACTCTGG + Intergenic
1032247613 7:130226189-130226211 TTTGAGTAATAATAATACTTTGG + Intergenic
1032351564 7:131168771-131168793 TTTTAGTGATAAGAAAACTGAGG + Intronic
1033069695 7:138190940-138190962 TTTGAGTAATAATAAAACTCCGG + Intergenic
1033075710 7:138248265-138248287 TTTTAATATTAAGAAAACTCAGG - Intergenic
1033082646 7:138312792-138312814 TTTGAGTAATAATAAAACTCTGG - Intergenic
1033340172 7:140485887-140485909 GTTGAGTAATAATAAAACTCTGG - Intergenic
1033609100 7:142948429-142948451 TTTGAGAAATGATAGAAATCAGG + Intronic
1033640831 7:143262333-143262355 TTTGAGTAATAATAAAACTCTGG - Intronic
1033906941 7:146216973-146216995 TTTGAGCAATATCAAAACTGTGG - Intronic
1033907528 7:146223772-146223794 TTTTATTAATAATAATACTTTGG - Intronic
1033942469 7:146672682-146672704 TTTGAGAAATACTAAAACTATGG - Intronic
1034004240 7:147451534-147451556 TGGGAGTAATAATACAACTAGGG + Intronic
1034009444 7:147512614-147512636 TTTAAATAAGAATAAAACTTAGG - Intronic
1034038996 7:147856771-147856793 TTCCAGGAATAATAAAACTCAGG + Intronic
1034042714 7:147896440-147896462 TTTGAGTAATAATAAAACTCTGG - Intronic
1034114365 7:148570643-148570665 TTTGAGTAATAACAAAACTCCGG - Intergenic
1034180736 7:149135655-149135677 TTAGAATAATAATAATAGTCCGG + Intronic
1034599434 7:152234933-152234955 GCTGAGTATTAATAAAACTGTGG - Intronic
1035716739 8:1761273-1761295 TTTGAGTAATAATAAAACTCTGG - Intronic
1035871700 8:3142145-3142167 ATTGAGTCACAATAAAACTCCGG + Intronic
1036047964 8:5165225-5165247 TTTAAGCAATAATTAAACTCTGG - Intergenic
1036200545 8:6767635-6767657 TTTGAGTAACGATAAAACTCCGG + Intergenic
1036763448 8:11529266-11529288 TTTGAGTAATAATAAGACTCCGG - Intronic
1036948495 8:13118792-13118814 TCTAAGTATTAATAAAACTCTGG + Intronic
1037014892 8:13891921-13891943 TTTGAGGTATTATAAGACTCTGG + Intergenic
1037116236 8:15231574-15231596 TTTGAGTAAAATAAAAACTTTGG + Intronic
1037134332 8:15444020-15444042 TTTAAGTAGTAATAAAACCCTGG + Intronic
1037330493 8:17739191-17739213 TATTATTAAAAATAAAACTCAGG + Intronic
1037465322 8:19154061-19154083 TTTGAGTAATAATAAAACTCTGG + Intergenic
1038283129 8:26183427-26183449 TTTGAGGAGTGAGAAAACTCTGG - Intergenic
1038497138 8:28011443-28011465 TTTGAGCAATAATCAAACTTTGG - Intergenic
1038666631 8:29543158-29543180 TTTGAGTAATAATAAAACTCTGG + Intergenic
1039013594 8:33122540-33122562 AATGAGTAATAATAAAACTCTGG + Intergenic
1039188723 8:34947507-34947529 TTTTAGCAATAAGAAAACTCAGG + Intergenic
1039259082 8:35751034-35751056 TTTGAGTAATAATAAAACTCCGG - Intronic
1039293286 8:36121944-36121966 TTTTAGAAATAAAAAAAATCAGG - Intergenic
1039694324 8:39894642-39894664 TTTGAGTAATAACAAAATTCTGG - Intergenic
1040498431 8:47987088-47987110 TTGGAGTAATAATAAAACTCTGG - Intergenic
1040713723 8:50221894-50221916 TTTGTGTAATAATAAAACTCTGG - Intronic
1040859075 8:51980266-51980288 TTTGAGTAATAGTAAAATTCTGG + Intergenic
1041105613 8:54440872-54440894 TTTTAGGAATAATAGTACTCGGG + Intergenic
1041183537 8:55273791-55273813 TTTGAGTAATAATAAAACTCTGG + Intronic
1041610565 8:59842593-59842615 TTTGAGTAAATATACAACTTTGG + Intergenic
1041758002 8:61334900-61334922 TTTGAGTAATAATAAAACTCTGG - Intronic
1041977757 8:63818767-63818789 CTTTAGTAATAATAAAACTTTGG - Intergenic
1042004610 8:64167644-64167666 TTTGAGTAATAATATAACTCTGG - Intergenic
1042309850 8:67369135-67369157 TTTGAGTAACAATAAACCTCTGG + Intergenic
1042700952 8:71613816-71613838 TTTGAGTCATATGACAACTCAGG - Intergenic
1042828885 8:73005794-73005816 TTTGAGTAATAATAAAACTCTGG + Intergenic
1042983652 8:74558447-74558469 TTTGAGTAATAATAAAACTCCGG + Intergenic
1043250737 8:78069894-78069916 TTTGAGTAATAATAAAACTCTGG + Intergenic
1043250842 8:78071165-78071187 TCTGAGCAATAATAAAACTCTGG + Intergenic
1043269840 8:78318544-78318566 TTTGAGCAATAACAAATTTCTGG + Intergenic
1043706028 8:83352107-83352129 TTTGAGTAATAATAAAACTCTGG - Intergenic
1043778405 8:84300177-84300199 TTTGATAAATAATAAAATTAAGG - Intronic
1043944880 8:86238445-86238467 TTTGAGTAATAATAAAACTTCGG + Intronic
1044003558 8:86915032-86915054 TTTGAGTAATAATACAACTGTGG - Intronic
1044014922 8:87039683-87039705 TTTGAGTAATTACAAAACTCTGG - Intronic
1044148956 8:88750102-88750124 TTTGAAAAATTAAAAAACTCTGG - Intergenic
1044175534 8:89116275-89116297 CTTGAGTAACAACAAAACTGAGG + Intergenic
1044198069 8:89402272-89402294 TTTGAGTAACCATAAAACTATGG + Intergenic
1044396831 8:91722406-91722428 TTTGAGTAATAATAAAAGTTTGG + Intergenic
1045638957 8:104225473-104225495 TTGGTGTAAAAATAAAAATCTGG - Intronic
1045676312 8:104611949-104611971 TTTGGGTAACAATAAAATTGAGG - Intronic
1045786042 8:105921685-105921707 TTGGAGTAATAATAAAACTCTGG + Intergenic
1045828797 8:106433088-106433110 TTTGAGCAATAATAAAACTCCGG - Intronic
1046933979 8:119868878-119868900 TTTGAGTAATAATAAAACTCTGG + Intergenic
1047025812 8:120823090-120823112 TTTTATGTATAATAAAACTCAGG + Intergenic
1047092245 8:121587080-121587102 TTGGAATAAAAATAAAGCTCTGG - Intergenic
1047567962 8:126066892-126066914 TTTGAGCAATAATAAATGCCCGG - Intergenic
1047655325 8:126971008-126971030 TTTGAGTAATAATAAGAGTCTGG - Intergenic
1048053639 8:130843519-130843541 TTAAAGCAATAATAAAGCTCAGG + Intronic
1048403186 8:134091135-134091157 TCTGATTAATTATAAAACACTGG - Intergenic
1048800862 8:138192756-138192778 TTTGAGTAACAATAAAACTCAGG + Intronic
1048930497 8:139311546-139311568 ACTGACTCATAATAAAACTCTGG + Intergenic
1049453174 8:142673578-142673600 TTTGAGTGATGATAAAACTCTGG - Intronic
1050163264 9:2739737-2739759 TTTGAGTAATAATAAAACTCTGG - Intronic
1050874521 9:10617450-10617472 TTTGAGTAATAATAATGTTTTGG - Intergenic
1051266878 9:15317875-15317897 TTTGAGGAATAATAAAACTCTGG - Intergenic
1051596713 9:18831167-18831189 CTTGAGTAAAAATAAGACACAGG + Intronic
1051698465 9:19793724-19793746 TATGAGGAATAGTAGAACTCGGG - Intergenic
1051847860 9:21473051-21473073 TCTGAGTAATACGAAAACTATGG - Intergenic
1051939094 9:22483172-22483194 TTTGAGTATTAATAAACTTAAGG - Intergenic
1051974682 9:22935146-22935168 TTTGAGTAACAATAGAATCCTGG + Intergenic
1052073952 9:24117921-24117943 CTTGAGTAATAATAAAACTCTGG - Intergenic
1052873416 9:33531281-33531303 TATGTTTAATAAAAAAACTCAGG - Intronic
1053450117 9:38186720-38186742 TTTGAGTAATAATAAAACTCTGG - Intergenic
1053451119 9:38194922-38194944 CTTGAGTAATAATAAAACTCTGG + Intergenic
1053502684 9:38613465-38613487 TATGTTTAATAAAAAAACTCAGG + Intergenic
1053803495 9:41778527-41778549 TTTGAGTAATAATAAAACTCTGG + Intergenic
1054461524 9:65467772-65467794 TTTGAGTAATAATAAAACTCTGG - Intergenic
1054775360 9:69120397-69120419 TTTGAGTAATAATAAAACTCCGG + Intergenic
1055000531 9:71444370-71444392 TTTGATTAATAGTAAAACATGGG - Intronic
1055216753 9:73872828-73872850 TTTGAGTAGTAATAAAACTCCGG + Intergenic
1055410891 9:76028357-76028379 TTTGAGCAATAATAAAACTCTGG - Intronic
1055450344 9:76425694-76425716 TTTCAGTGATAATAAAACTCAGG - Intronic
1055851130 9:80631079-80631101 TTTGAGTAATAATAGAACTGTGG + Intergenic
1055878906 9:80974983-80975005 TTTGAGTAATAATAAAACTCTGG + Intergenic
1056213865 9:84390358-84390380 TTTGTGTAATAATAAAACTCTGG - Intergenic
1056221034 9:84450962-84450984 TTTGAGTAATAATAAAACTCCGG + Intergenic
1056518137 9:87374263-87374285 TTTGAGTAATAATAAAACTCTGG - Intergenic
1056562415 9:87743165-87743187 TTTGAGTGATAATACAGCTCTGG + Intergenic
1056638998 9:88354282-88354304 TTTGAGTAATAAAAAAACTCTGG + Intergenic
1056640140 9:88362856-88362878 ATTGAGTAATAATACAGCTCTGG - Intergenic
1057153404 9:92816166-92816188 TATGTTTAATAAAAAAACTCAGG - Intergenic
1057318532 9:93989745-93989767 TTTGAGTAATAATAAGACTCTGG + Intergenic
1057417627 9:94878914-94878936 TTTGAGTAATAATAAAACTCCGG - Intronic
1057682513 9:97202743-97202765 TATGTTTAATAAAAAAACTCAGG + Intergenic
1058060940 9:100495247-100495269 TATGAGTAATAGTAAAAGACAGG - Intronic
1059022536 9:110592185-110592207 TTTGAGTAATAATACAGCTCTGG - Intergenic
1059060197 9:111027821-111027843 TTAGAGTAAGGATAGAACTCTGG + Intronic
1059133205 9:111776933-111776955 TTTGAGTAATAATAAAAGACCGG - Intronic
1059136412 9:111810842-111810864 TTTGAGTAATAATAAAACTCTGG + Intergenic
1059785021 9:117572177-117572199 TTTGAGTAATAATAAAACCCTGG + Intergenic
1060079169 9:120625305-120625327 TTTGAGTAATAATAAAGCTCTGG - Intronic
1060092608 9:120756655-120756677 ATTGAGTAAAAATAAAACACAGG + Intronic
1061088995 9:128416055-128416077 TTTAAGTAATAATAAAACTCCGG - Intronic
1062222366 9:135423888-135423910 TTTGAGTAATAGTAAAACTCCGG + Intergenic
1062228758 9:135469178-135469200 TTTGAGTAACGATAAAACTCCGG + Intergenic
1203628795 Un_KI270750v1:50919-50941 ATTAGGTAATAATAGAACTCCGG + Intergenic
1185446693 X:261567-261589 TTTGAGGAATAAGGAAACTCCGG - Intergenic
1185775986 X:2803471-2803493 TTTGAGTAATAATAAAACTCTGG - Intronic
1185842084 X:3401204-3401226 TTTGAGTAATAATAAAACTCTGG - Intergenic
1185946734 X:4385162-4385184 TTCGAATAATAATAAAACTCTGG + Intergenic
1185974967 X:4710140-4710162 TTTGAGTAATAATAAAACTCGGG + Intergenic
1186027331 X:5327384-5327406 CTTGAGCAATAATAAAACTCTGG - Intergenic
1186153043 X:6695919-6695941 TTTGAGTAATAATAGAACTCCGG + Intergenic
1186711249 X:12199773-12199795 TTTGAGTAATAATAAAACTCTGG - Intronic
1186816459 X:13242353-13242375 TTTGAGTAATAATAAAACTCTGG + Intergenic
1186817185 X:13249542-13249564 TTTGACTAATAATAAAACTCCGG + Intergenic
1186833223 X:13411861-13411883 TTTGAGTAATAATAAAACTCTGG + Intergenic
1187161507 X:16769393-16769415 TCACAGTAATAATAAAACTCCGG + Intergenic
1187492218 X:19762620-19762642 CTTGAGTAATAATAAAACTCTGG + Intronic
1187841525 X:23493901-23493923 TTTGAGTAATAATAAAACTCTGG - Intergenic
1188148560 X:26644752-26644774 TTTGAGTAATAATAAAACTCTGG - Intergenic
1188179801 X:27040531-27040553 TTTGAGTAATAATAAAATGCTGG + Intergenic
1188206561 X:27366522-27366544 TTTAAAAAATAATAAAACTATGG + Intergenic
1188266593 X:28084034-28084056 TGTCAGTAATAATAATACTAGGG - Intergenic
1188286284 X:28328846-28328868 TTTGAGTAATAATAAAACTCTGG - Intergenic
1188686554 X:33076858-33076880 TTTGAGTAATAATAAAACTTCGG - Intronic
1188764120 X:34070051-34070073 TTTTAGAAATTATAAAAATCAGG - Intergenic
1188871720 X:35381691-35381713 TTTGAGTAATAATAAAACTCTGG - Intergenic
1188881215 X:35494172-35494194 TTTGAGTAATAATAAAACTCTGG - Intergenic
1188999724 X:36931007-36931029 TCTAAGTAATAATAAAACTATGG - Intergenic
1189194136 X:39138194-39138216 TTTGAGTAATAATGAAACTCTGG - Intergenic
1189260809 X:39677736-39677758 TTTGAGTAAACAAAAACCTCTGG + Intergenic
1189382800 X:40513728-40513750 TTTAAGGATTCATAAAACTCAGG + Intergenic
1189411429 X:40775959-40775981 TTTGAGTATTAAAATAACTAAGG - Intergenic
1189415226 X:40806838-40806860 TTTGAGTAGTAATAAAACTCTGG - Intergenic
1189483433 X:41410813-41410835 TTTGAACAATTATAAAACTGGGG - Intergenic
1189758987 X:44301382-44301404 TTTGAGTAATATTAAAACTCTGG + Intronic
1189792856 X:44620112-44620134 TTTGAGTAATAATAAAACTCCGG + Intergenic
1189953631 X:46257153-46257175 TTTGAGTAATAATAAAACTCAGG - Intergenic
1189960885 X:46323875-46323897 TTTGAGTAATAATAAAACTCTGG - Intergenic
1190083757 X:47377293-47377315 TTTGAGTATTAATACAACTCTGG + Intronic
1190368671 X:49721305-49721327 TTTGGGTAATAATAAAACTATGG + Intergenic
1190408340 X:50110095-50110117 TTTGAGTAATAATAAAACTCTGG - Intergenic
1190477509 X:50842542-50842564 TTTGTGTAATAATAAAACTCTGG - Intergenic
1190523806 X:51308203-51308225 TTTGGGTAATAATGAAAGTAAGG - Intergenic
1190806796 X:53845399-53845421 TTCAAGTTATGATAAAACTCAGG - Intergenic
1191219578 X:57973891-57973913 TTTGAGTGATAATAAACCTCTGG - Intergenic
1191220163 X:57979312-57979334 TCTGAGTAATAATAAAATTCTGG - Intergenic
1191845222 X:65542162-65542184 CTTGAGTGATAATAAAACTCAGG + Intergenic
1192063526 X:67856052-67856074 TTTGAGTAATAACAAAACTCTGG + Intergenic
1192300589 X:69897500-69897522 TTTAAGTAAAAGTAAAACCCTGG - Intronic
1192338776 X:70244211-70244233 TTTGAGTAATAATAAAACTCTGG + Intergenic
1192414838 X:70969955-70969977 CGTGAGTAATAATAAAACTCTGG - Intergenic
1192463285 X:71336299-71336321 TTTGAGTAATAATAAAACTCCGG - Intergenic
1192812345 X:74558482-74558504 TTTGAGTAATAACAAAACTCCGG + Intergenic
1192812432 X:74559226-74559248 TTTGAGTAGTAATAAAACTCTGG + Intergenic
1193148637 X:78103072-78103094 TTTGAGTGATAATGAAACTCTGG + Intronic
1194073720 X:89361567-89361589 TATCAGTAATAATAAAATTTTGG - Intergenic
1194111193 X:89836761-89836783 TTTGAGTAATAATAAAACTCTGG - Intergenic
1194316587 X:92384509-92384531 TTTGAGTAATAATAAAACTCTGG - Intronic
1194345947 X:92765871-92765893 TTTGAGTAATAATAAAACTTTGG + Intergenic
1194359964 X:92937873-92937895 TTTGAGTAATAATAAAACTCTGG + Intergenic
1194393847 X:93355019-93355041 GACGAGTAACAATAAAACTCTGG + Intergenic
1194447694 X:94007991-94008013 TTTGAGTCATAGTAAAGCTCTGG - Intergenic
1194620249 X:96162213-96162235 TTTGCATAATAATAAAATTCTGG - Intergenic
1195086950 X:101421940-101421962 TTTAAGTAATAACAAAACTCTGG - Intronic
1195258651 X:103112483-103112505 TTTGAGTAATAATAAAACTCTGG + Intergenic
1196082214 X:111645214-111645236 TTTGAGTAATAATAAAACTCCGG - Intergenic
1196093595 X:111774342-111774364 TTTGAATAATAATAGAACCTGGG - Exonic
1196132600 X:112173462-112173484 TTTTAGTAATGAGAAAACTGAGG - Intergenic
1196512394 X:116527758-116527780 TTTTAATAATATTAAAATTCTGG + Intergenic
1196963510 X:121030068-121030090 TTTGAGTAATAATAAAACTCAGG - Intergenic
1196997455 X:121399992-121400014 TTTGAGTAATGATAAAACTCCGG - Intergenic
1197024399 X:121730459-121730481 TTTGAATAGAAATAACACTCTGG - Intergenic
1197066992 X:122245471-122245493 ATTGAGTAATAATAAAACTCTGG - Intergenic
1197111119 X:122776030-122776052 TTTGAGTAATAATAAAACTCTGG + Intergenic
1197209543 X:123817545-123817567 TTTGGGTAATAATAAAACTCTGG - Intergenic
1197244114 X:124150712-124150734 TGTGAGTAATAATAAAACTCTGG - Intronic
1197294728 X:124704971-124704993 TTTGATTAAGAACAAAACTGAGG + Intronic
1197678751 X:129359631-129359653 TTTGAGTAATAATAAAACTCTGG + Intergenic
1198213149 X:134533611-134533633 TTTGGGTAATAATAAAACTCCGG + Intergenic
1198382243 X:136094696-136094718 TTTGAGTAATAATAAAACTCTGG + Intergenic
1198698456 X:139369527-139369549 TTTGAGTAGTAATATAACTGTGG - Intergenic
1198952238 X:142084349-142084371 TTTCAGTAATAATAAAACTCAGG - Intergenic
1199133352 X:144220842-144220864 TCTGGGTAATAAAAAAAGTCTGG - Intergenic
1199166452 X:144681464-144681486 TTTGAGTAGTAATAAAACTCTGG - Intergenic
1199186156 X:144918049-144918071 TTTGCATAATAATAAAACTCTGG + Intergenic
1199321641 X:146446479-146446501 TTTGAATAATAATAAAACTCTGG + Intergenic
1199362123 X:146933358-146933380 TTTGAGTAATAATAAAACTCTGG + Intergenic
1199478090 X:148268358-148268380 TTTCACAAATAATAAAACTAAGG + Intergenic
1200463857 Y:3491504-3491526 TTTGAGTAATAATAAAACTCTGG - Intergenic
1200624761 Y:5497829-5497851 TTTGAGTAATAATAAAACTCTGG - Intronic
1200654293 Y:5882519-5882541 TTTGAGTAATAATAAAACTTTGG + Intergenic
1200668164 Y:6053694-6053716 TTTGAGTAATAATAAAACTCTGG + Intergenic
1201294011 Y:12448230-12448252 TTTGAGTAATAATAAAACTCTGG + Intergenic
1201642130 Y:16191267-16191289 TTTGAATAATAATAAAACTCTGG + Intergenic
1201660685 Y:16394054-16394076 TTTGAATAATAATAAAACTCTGG - Intergenic
1201733325 Y:17229665-17229687 TATGAGTAATATTAAAACTCTGG - Intergenic
1201733935 Y:17236748-17236770 TTTGGACAATAATAAAACTCTGG + Intergenic
1201749069 Y:17412919-17412941 TTTGAGTAATAATAAAACTCTGG + Intergenic
1201939375 Y:19443529-19443551 ATTGAGTAATTATAAAACTCTGG + Intergenic