ID: 918628311

View in Genome Browser
Species Human (GRCh38)
Location 1:186684086-186684108
Sequence CTCCATGAAAACCAGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918628306_918628311 25 Left 918628306 1:186684038-186684060 CCATACAAGAAGAACAACTTACT No data
Right 918628311 1:186684086-186684108 CTCCATGAAAACCAGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918628311 Original CRISPR CTCCATGAAAACCAGTACCT GGG Intergenic
No off target data available for this crispr