ID: 918638338

View in Genome Browser
Species Human (GRCh38)
Location 1:186807155-186807177
Sequence GGTCTTTGGTCCCTACTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918638338_918638343 10 Left 918638338 1:186807155-186807177 CCTATAAGTAGGGACCAAAGACC No data
Right 918638343 1:186807188-186807210 TCTTTCTGGCCGCTTCCAGAAGG No data
918638338_918638341 -4 Left 918638338 1:186807155-186807177 CCTATAAGTAGGGACCAAAGACC No data
Right 918638341 1:186807174-186807196 GACCAAAAGTGGTCTCTTTCTGG No data
918638338_918638344 11 Left 918638338 1:186807155-186807177 CCTATAAGTAGGGACCAAAGACC No data
Right 918638344 1:186807189-186807211 CTTTCTGGCCGCTTCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918638338 Original CRISPR GGTCTTTGGTCCCTACTTAT AGG (reversed) Intergenic
No off target data available for this crispr