ID: 918647724

View in Genome Browser
Species Human (GRCh38)
Location 1:186921835-186921857
Sequence TGTCCTCTTGACCACTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 11, 2: 26, 3: 60, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918647716_918647724 22 Left 918647716 1:186921790-186921812 CCTTCCTTAACTAACTGTCCCTT 0: 10
1: 9
2: 12
3: 25
4: 188
Right 918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG 0: 1
1: 11
2: 26
3: 60
4: 174
918647719_918647724 3 Left 918647719 1:186921809-186921831 CCTTTGCTACTAGTACTGCTGCT 0: 17
1: 35
2: 19
3: 32
4: 219
Right 918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG 0: 1
1: 11
2: 26
3: 60
4: 174
918647718_918647724 4 Left 918647718 1:186921808-186921830 CCCTTTGCTACTAGTACTGCTGC 0: 21
1: 33
2: 14
3: 27
4: 170
Right 918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG 0: 1
1: 11
2: 26
3: 60
4: 174
918647717_918647724 18 Left 918647717 1:186921794-186921816 CCTTAACTAACTGTCCCTTTGCT 0: 14
1: 7
2: 13
3: 34
4: 213
Right 918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG 0: 1
1: 11
2: 26
3: 60
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918647724 Original CRISPR TGTCCTCTTGACCACTGTGG GGG Intronic
900431498 1:2605138-2605160 GGTCCCCTTGTCCACAGTGGGGG + Intronic
902073403 1:13762365-13762387 TGTCCCCTTCCCCAGTGTGGTGG - Intronic
902383681 1:16064601-16064623 TGTCCCCTTTACCACTGGGTGGG + Intronic
902986087 1:20155139-20155161 TATCCTCTTAACCACTGTGGGGG - Intergenic
903184462 1:21621512-21621534 TGTCCTATGGACTCCTGTGGTGG - Intronic
903484105 1:23676828-23676850 TAGACTCTTGACCACTGTGGAGG + Intergenic
904915769 1:33969702-33969724 TGTGCTCTTAGCCACTGTGCTGG + Intronic
905844554 1:41217790-41217812 TGTCCTCTGGACTGCTGGGGTGG - Intronic
906499511 1:46331246-46331268 TATTCTCTTGACTGCTGTGGGGG + Intergenic
906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG + Intronic
908494938 1:64685423-64685445 TGTACCCTTGTACACTGTGGAGG + Intronic
911973886 1:104467297-104467319 TGTACTCTTAGCCACTGTGGGGG + Intergenic
912815853 1:112827445-112827467 TGTTCTCTCAACCACTGTGGGGG - Intergenic
912980604 1:114368266-114368288 TGTCCTCTTAAGCACTGTGGGGG + Intergenic
913324684 1:117616464-117616486 TGTCCTCTTGTACACGGGGGAGG + Intronic
917326111 1:173834491-173834513 GGTCCTCTTAAACAATGTGGGGG - Exonic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
919296006 1:195701080-195701102 TGTACTTTTAACCACTGTGTTGG - Intergenic
921747479 1:218754112-218754134 TGTCCTCTTAGCCACTGTGGGGG + Intergenic
924864662 1:247965600-247965622 TGCCATCTTGGGCACTGTGGTGG - Exonic
1065129186 10:22603251-22603273 AGGCCTCTTGTTCACTGTGGAGG - Intronic
1065613886 10:27500607-27500629 TGTCATTTTGACCACTTGGGTGG - Intergenic
1066389868 10:34970033-34970055 TGCCCTCTTAGTCACTGTGGGGG - Intergenic
1069939011 10:71940709-71940731 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1070403147 10:76070978-76071000 TGCCCTCTGGACAGCTGTGGAGG + Intronic
1071281699 10:84109718-84109740 TGTCCTCTTAATTACCGTGGGGG - Intergenic
1071288459 10:84171037-84171059 TGTTCTTTTAACTACTGTGGAGG + Intergenic
1075141822 10:119844559-119844581 TGTGCTCTTAACCTCTGTGATGG + Intronic
1076597344 10:131632191-131632213 TGTCCTCGTCACCACAGTAGAGG - Intergenic
1077589546 11:3480892-3480914 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1080839540 11:35971299-35971321 TGACCTGTTGGACACTGTGGTGG + Intronic
1083197120 11:61094980-61095002 TGTCCTCTTAACCACTGCGGGGG - Intergenic
1084245267 11:67852666-67852688 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1084827421 11:71741912-71741934 TGCCCTCTTAGCCACAGTGGGGG - Intergenic
1086973644 11:93109571-93109593 TGTTCTCTCAACCACTGTGTGGG + Intergenic
1087684317 11:101245824-101245846 AGTTCTCTCAACCACTGTGGAGG - Intergenic
1087894603 11:103573325-103573347 TGTTCTCTTAACCACTGTGGCGG - Intergenic
1089177298 11:116558056-116558078 TGTGCTCTTGCTCACAGTGGTGG - Intergenic
1089213582 11:116822232-116822254 TGTCTTCTTGACCTCTGCTGGGG + Intronic
1090665341 11:128911498-128911520 TGACCTCTTCACCACCCTGGTGG + Exonic
1092308343 12:7324647-7324669 TGTCCATTTGACCACTGTAAAGG + Intronic
1092415837 12:8289798-8289820 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1093288751 12:17298123-17298145 TGTCCTCTTAACCACTGTGGTGG - Intergenic
1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG + Intergenic
1098248192 12:68541511-68541533 TGTTCTCTCAGCCACTGTGGCGG - Intergenic
1098639571 12:72823339-72823361 TGTTCTCTTAACTACTGTGGGGG + Intergenic
1098748100 12:74265570-74265592 TGTCTTCTTAACCACTGTGGGGG - Intergenic
1098898153 12:76085205-76085227 TTTCCTCTAGACCACTTCGGCGG + Intergenic
1099876462 12:88412823-88412845 TGTTCTAATGAGCACTGTGGAGG - Intergenic
1100260425 12:92928535-92928557 TCTCCTTTGGACCACAGTGGAGG - Intronic
1101029780 12:100647338-100647360 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1101648861 12:106656576-106656598 CATCCTCTTCACCACAGTGGGGG + Intronic
1101693745 12:107105518-107105540 GATCCTCTTGAGCCCTGTGGAGG - Intergenic
1101960042 12:109242265-109242287 TCCCTTCTTCACCACTGTGGAGG - Intronic
1102944437 12:116973647-116973669 TGTCCTCTTCAGCACTGTCAAGG + Intronic
1103210503 12:119162712-119162734 CGTCCCCTTGGCCAATGTGGTGG - Exonic
1104292335 12:127482050-127482072 TGTCCTCTTAACCACTGTCAGGG - Intergenic
1104993728 12:132641471-132641493 TATTGTCTTTACCACTGTGGGGG - Intronic
1105012763 12:132766612-132766634 TGCCCTCTTCACCTCTGTGTGGG - Intergenic
1105498244 13:20949401-20949423 TGTCATCTATGCCACTGTGGAGG - Intergenic
1105604710 13:21917364-21917386 TGACCCCTTGACCTCTGGGGAGG + Intergenic
1105629822 13:22151691-22151713 TATCCTCTTCACCATTGTGATGG - Intergenic
1107491048 13:40880070-40880092 TGTCCTCTTAACCACGGTGGGGG + Intergenic
1108044820 13:46373722-46373744 TCTCCTGTTCACCACTGTGCAGG - Intronic
1109802476 13:67398453-67398475 TGTCCTCTTAACCAATGTAGGGG - Intergenic
1112299226 13:98214944-98214966 TTTCCTGTTGAGCACTGTGAAGG + Intronic
1117955480 14:61120259-61120281 TGTCCTCTCAACCACTGTGGGGG + Intergenic
1118419902 14:65590494-65590516 TCTCCTCTTGACCAAACTGGGGG + Intronic
1120743783 14:88135572-88135594 TGTCCTCTTTACCACTCCGAGGG + Intergenic
1122283245 14:100636589-100636611 TGCCCTGTGGACCACTGCGGTGG + Intergenic
1124551942 15:30689189-30689211 TGTCCTGTTGCTCTCTGTGGAGG + Intronic
1124679304 15:31716482-31716504 TGTCCTGTTGCTCTCTGTGGAGG - Intronic
1125738444 15:41944509-41944531 TGTCCACATGTGCACTGTGGAGG - Intronic
1126166855 15:45660810-45660832 TGTCCTCTTCACCTCTCTGTGGG + Intronic
1130262041 15:82362877-82362899 TGTCCCTTTGACCAGTGTGGGGG + Intergenic
1130279191 15:82506130-82506152 TGTCCCTTTGACCAGTGTGGGGG - Intergenic
1130314214 15:82781419-82781441 TGTACTCTTGGACAATGTGGGGG + Intronic
1130622940 15:85482940-85482962 TGTCCCTTTGACCAGTGTGAGGG + Intronic
1131736308 15:95336028-95336050 TGTCTTCTTGGCCAGGGTGGTGG - Intergenic
1132203586 15:99971366-99971388 TGTCTCCTTCCCCACTGTGGTGG - Intergenic
1132859248 16:2061906-2061928 TGACCTGTTGACCACGGTGGAGG + Exonic
1134442101 16:14304325-14304347 TGTCCCTTAAACCACTGTGGGGG - Intergenic
1137029048 16:35505800-35505822 TCTCCTCTTTATCACAGTGGCGG + Intergenic
1137041792 16:35620044-35620066 TGTTCTCTCAACCACTGTGGTGG + Intergenic
1140079617 16:71732860-71732882 TGTCCTCTCCTCCACTGTTGAGG - Exonic
1140755047 16:78059310-78059332 TGCCCTCTTAACCACTGTGGGGG + Intronic
1141737957 16:85867710-85867732 TGTCCTTCTTTCCACTGTGGAGG + Intergenic
1142073293 16:88103215-88103237 TGGCCTCTCGCCCAGTGTGGTGG + Intronic
1142694316 17:1625019-1625041 TGTCCTCTTGGCCTCTGGGATGG - Intronic
1145865400 17:28238000-28238022 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1145902171 17:28496263-28496285 GGGCCTCTTGACCTCTCTGGAGG - Intronic
1146564689 17:33902497-33902519 TGTCCACTTCAGCACTGTGGTGG + Intronic
1146763943 17:35501887-35501909 TGTTCTCTCAACCACTGTGGGGG - Intronic
1146824948 17:36013896-36013918 TCTCCTCCAGAGCACTGTGGAGG + Exonic
1147443239 17:40460179-40460201 GGTCCTCTTTCCCAGTGTGGGGG + Intergenic
1147552332 17:41452492-41452514 GGTCCACTTAACCACTGTGTTGG - Intergenic
1148129674 17:45255326-45255348 GCCCCTCCTGACCACTGTGGAGG - Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1152453495 17:80398613-80398635 TGTTCTCTCAACCACTGTTGGGG - Exonic
1153284514 18:3445847-3445869 GGGCCTCCTGAACACTGTGGGGG - Intronic
1153413098 18:4815991-4816013 GGTCCTCTTCCACACTGTGGAGG + Intergenic
1153504794 18:5786098-5786120 TGTCCACTTGACAACTATTGGGG + Intergenic
1153830183 18:8914930-8914952 TGTTCTCTCAACCACTTTGGTGG - Intergenic
1158291707 18:55951669-55951691 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1160038471 18:75322200-75322222 GGTCCTGGTGGCCACTGTGGGGG + Intergenic
1160982219 19:1821660-1821682 GGTCCTCTTGGCACCTGTGGGGG + Exonic
1162235072 19:9302544-9302566 TGTCCTCTTGTACACATTGGAGG - Intronic
1162284718 19:9729594-9729616 TGTCATCTTAACCACTGTGGGGG + Intergenic
1162633442 19:11946504-11946526 TGTCCTCTCAACCACTGTGGGGG + Intronic
1163237154 19:16036553-16036575 GGTCATCCTGGCCACTGTGGAGG + Intergenic
1163916478 19:20244951-20244973 TGTCCTCTCAACCACTGTGGGGG - Intergenic
1163943713 19:20517262-20517284 TGTCCTCTTAACTACTGTGGGGG + Intergenic
1163966895 19:20754298-20754320 TGCCCTCTTAGCCACTGTGGGGG + Intronic
1163991601 19:21003658-21003680 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1164217536 19:23162971-23162993 TGTTCTCTCAACCACTGTGGGGG + Intergenic
1164480485 19:28607785-28607807 TGTCCTCTTAACCACCATGGGGG - Intergenic
1166876950 19:45903059-45903081 TGTCTCCTTGACAACTGTGTGGG + Intergenic
1167935474 19:52903402-52903424 TGTTCTTTTAACTACTGTGGGGG + Intergenic
925917844 2:8619421-8619443 TGTCCTCTTGGCCCCTGAGAAGG + Intergenic
926351003 2:11994289-11994311 TGTCCTCTGGACCACCAGGGAGG - Intergenic
926701440 2:15806802-15806824 TGTGCTCTTGAGCACAGAGGAGG + Intergenic
927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG + Exonic
930517965 2:52432045-52432067 TGTCCTCTTAACCACTGTGGGGG - Intergenic
931699577 2:64898755-64898777 TGTCCTCTTAACCACGGTGCAGG + Intergenic
932352938 2:71046598-71046620 TGGCCTCTTAGCCACTGTGGGGG - Intergenic
932600201 2:73118746-73118768 TGTAGTCCTGACCACTGAGGGGG + Intronic
933936014 2:87204325-87204347 TGTCCTCTTAACGACTGTGGGGG + Intergenic
934591234 2:95551685-95551707 TGCCCTCTTAGCCACTTTGGGGG - Intergenic
934620679 2:95802601-95802623 TGTCCTTGTGACAACTGTAGGGG + Intergenic
934812757 2:97297122-97297144 TGTCCTTGTGACAACTGTAGGGG - Intergenic
934824938 2:97411350-97411372 TGTCCTTGTGACAACTGTAGGGG + Intergenic
936357134 2:111761504-111761526 TGTCCTCTTAACGACTGTAGGGG - Intergenic
938702946 2:133895259-133895281 TGTCATCTTAACCACTGTCGGGG - Intergenic
940873868 2:158881898-158881920 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
946453625 2:219802308-219802330 TCTCCTTTTGGTCACTGTGGAGG + Intergenic
947594440 2:231402021-231402043 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1171407354 20:24920545-24920567 TGCCCTTTTAGCCACTGTGGGGG - Intergenic
1173876129 20:46373124-46373146 TATCCTCCTGACCTCTCTGGAGG + Intronic
1174422990 20:50412408-50412430 TGTTCTCTTGCCCTCAGTGGAGG - Intergenic
1175539126 20:59737181-59737203 TGTCCTGTTCCCCACTGGGGCGG + Intronic
1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG + Intronic
1175730498 20:61350569-61350591 TGGCCTCTGCAGCACTGTGGGGG - Intronic
1175887491 20:62300724-62300746 GGTCCTCTTGGCCACTGCGTTGG + Intergenic
1175921123 20:62451061-62451083 ACTCCCCATGACCACTGTGGTGG + Intergenic
1177138962 21:17338029-17338051 TGCCCACTTGATCACTGGGGTGG + Intergenic
1177516640 21:22160047-22160069 TCTCAACTTGACCACTGTTGGGG + Intergenic
1180825354 22:18857532-18857554 TGCCATCCTGACCACTGTGTGGG + Intronic
1182850848 22:33472972-33472994 TGTCTTCTAGAGCACTGGGGTGG + Intronic
949157592 3:847883-847905 TGTCCTCTTAACCACTGTGGTGG - Intergenic
951166513 3:19489379-19489401 TGTCCTCTTAACCACTGTGAGGG + Intronic
951275871 3:20685243-20685265 CTTTCTCTTGACCACTGTGTTGG - Intergenic
956995971 3:74826323-74826345 TGTTCTCTTAACTACCGTGGGGG - Intergenic
957405763 3:79774162-79774184 TGTCCTCTTAACCGCTGTGGGGG - Intergenic
957800160 3:85067937-85067959 TGTCCTCTTGAGAATTGTGTGGG + Intronic
960627503 3:119695373-119695395 TGCCCTGTTGGCCACTCTGGAGG - Intergenic
961271716 3:125694572-125694594 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
961547346 3:127644528-127644550 TGGCCTCAGGACCACAGTGGAGG + Intronic
961806136 3:129490698-129490720 TTCCCTCTTGGCCACTGTGCTGG + Intronic
961893383 3:130148411-130148433 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
964522931 3:157586709-157586731 TATCCTCTTAACCACTGTAGGGG + Intronic
967488678 3:190063667-190063689 TCTCCTCACGCCCACTGTGGTGG + Intronic
968541501 4:1170672-1170694 TGCCCTCTGCACCACTGTTGGGG + Intronic
968816979 4:2827367-2827389 CCTCCTCTTGGCCGCTGTGGAGG + Intronic
969147759 4:5139065-5139087 TGTCTCCTGGACCACTATGGTGG - Intronic
969668154 4:8574059-8574081 TGTCCGGGTGACCGCTGTGGGGG + Intronic
969749382 4:9098732-9098754 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
971027286 4:22600666-22600688 TGTTCTCTTAACTACTGTGGAGG - Intergenic
972076968 4:35101815-35101837 TGTCCCCTTAACCACTGCGGGGG - Intergenic
972336098 4:38108179-38108201 TGTCGTCCTGACCACGCTGGGGG + Intronic
974717090 4:65680860-65680882 AGTGCTGATGACCACTGTGGGGG + Intergenic
974987935 4:69052273-69052295 TGTTCTCTTAACTACTGTTGGGG - Intronic
975205452 4:71639586-71639608 TGTTCTCTCAACCACTGTAGGGG - Intergenic
975867255 4:78736787-78736809 TGTAGTCTTGACTACTCTGGAGG + Intergenic
976970525 4:91096461-91096483 TGTCCCCTTAACCACTATGGGGG + Intronic
977043783 4:92044904-92044926 TGTTCTCTTAACCACTGTTGGGG + Intergenic
977796192 4:101167946-101167968 TATCCTCTTGACCTCTCTAGTGG + Intronic
977972161 4:103224891-103224913 TATTCTCTCAACCACTGTGGTGG - Intergenic
980072807 4:128261291-128261313 TGTTCTCTCAACCACTGTGGTGG - Intergenic
980779623 4:137479574-137479596 TGTCCTCTTAACCACTCTGGGGG - Intergenic
981270382 4:142839930-142839952 TGTCCTCAAGATCAATGTGGTGG - Intronic
981604449 4:146527171-146527193 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
987930697 5:24396759-24396781 AGTTCTCTCAACCACTGTGGAGG + Intergenic
988145431 5:27299854-27299876 TCTCCTCTTCACCACTGTGAAGG + Intergenic
988806053 5:34741768-34741790 TGTACTCTTGTCCACTGCTGTGG - Intronic
989557551 5:42814713-42814735 TGTTCTCTTAACTACTGTAGCGG - Intronic
989776017 5:45207531-45207553 TGTTCTCTTAACTACTGTGGTGG - Intergenic
990714387 5:58620762-58620784 AGTCTTCTTGACTAATGTGGTGG + Intronic
990727735 5:58775150-58775172 AGTCCTTTTGACAAATGTGGTGG - Intronic
992989719 5:82272303-82272325 TGTTCTCTTAACTACTGTGGTGG + Intronic
995473316 5:112525163-112525185 TGTCCTCTTAACCACTGTGGGGG - Intergenic
995813407 5:116135822-116135844 AGTCCCCCTGCCCACTGTGGGGG - Intronic
996517915 5:124394092-124394114 CATCCTCTTGACCACTGTCAGGG + Intergenic
999326776 5:150648970-150648992 CGTCCTGTTGACCACTGATGGGG - Exonic
1000236629 5:159367461-159367483 TGTTCTCTCAACCACTGTTGGGG - Intergenic
1000604944 5:163318082-163318104 TGTTCTTTTAACTACTGTGGGGG + Intergenic
1001873760 5:175181548-175181570 TGACCTCTTAACCACTGGGCTGG + Intergenic
1004248314 6:14001684-14001706 TGGCCGCTTGACAACTCTGGTGG + Intergenic
1004314492 6:14574011-14574033 GGTCCTCTTTTCCTCTGTGGAGG - Intergenic
1004954073 6:20707530-20707552 TGTCTGCTTACCCACTGTGGTGG + Intronic
1005197932 6:23310611-23310633 AGACCTCCTGCCCACTGTGGAGG - Intergenic
1006032215 6:31185460-31185482 TGTTCTCTTAACTACTGTAGGGG + Intergenic
1006570573 6:34999768-34999790 TGTTCTCTTAACTACTGTGGCGG - Intronic
1006843400 6:37046464-37046486 TGTACTCTCAACTACTGTGGAGG + Intergenic
1008123263 6:47641668-47641690 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1010317719 6:74469566-74469588 TGTTCTCTTAACTACTGTAGTGG - Intergenic
1011564799 6:88663457-88663479 TGTCCTCTTAGCCACTGTGAGGG - Intronic
1012612243 6:101230576-101230598 TGTCCTATTAACTACTGTGGGGG + Intergenic
1013194502 6:107833382-107833404 TCTCCGCTTGAACCCTGTGGAGG + Intergenic
1013559326 6:111289189-111289211 TGTTCTCTTAACTACTGTTGCGG + Intergenic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1013978784 6:116105422-116105444 TGTCCTTTTGGACACTGTGCAGG + Intronic
1014281020 6:119442530-119442552 TTTCCTCTTGTCCACCTTGGTGG - Intergenic
1014547272 6:122747968-122747990 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1018360788 6:163065459-163065481 TGCCCTCTTGACCGCTGTTTTGG - Intronic
1018754536 6:166837646-166837668 TGTCCTCATCACCTCTGTGGGGG + Intronic
1020260670 7:6529104-6529126 TGTCCTCTTGACCCCTGCCCAGG - Intronic
1020323610 7:6957908-6957930 TGCCCCCTTAGCCACTGTGGGGG + Intergenic
1021849541 7:24794469-24794491 TGTCTTCTTAACCACCGTGGGGG + Intergenic
1021954131 7:25806895-25806917 TGACTTCTTAAGCACTGTGGTGG - Intergenic
1022202149 7:28127052-28127074 TGTCCTGTTGACCACTGCCTGGG - Intronic
1024555979 7:50604072-50604094 TGTCCTGTGAATCACTGTGGGGG + Exonic
1026281112 7:68922476-68922498 TGTGCTCTTAACCACTCTGCCGG + Intergenic
1030986619 7:116249062-116249084 TGTCCTCTTGAGCAATGAAGAGG + Exonic
1032170430 7:129579680-129579702 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1032782264 7:135172771-135172793 TGTTCTCTTAACTACTGTGGTGG - Intergenic
1032979642 7:137267379-137267401 TGTTCTCTTAACTACTGTTGGGG + Intronic
1034267353 7:149787622-149787644 TGTCCGCTGGTCCACTGTGCTGG + Intergenic
1036372453 8:8173075-8173097 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1036493664 8:9250490-9250512 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1036817173 8:11910790-11910812 TGCCCTCTCAGCCACTGTGGGGG + Intergenic
1036820472 8:11935681-11935703 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1036878450 8:12492566-12492588 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1037725101 8:21476903-21476925 TGTCCTGCTGACTAATGTGGTGG - Intergenic
1039498630 8:38000001-38000023 TGTCCTCTACTCCACTGTGCTGG + Intergenic
1039877041 8:41595895-41595917 TGTTCTCTCAACCACTGTGGCGG + Intronic
1040622095 8:49102454-49102476 GGTCCTCTTCCACACTGTGGAGG - Intergenic
1047014523 8:120709702-120709724 TTTCCTCTTTCCCACTGTGTTGG + Intronic
1049087489 8:140489953-140489975 GGTCCTCTTCCACACTGTGGAGG - Intergenic
1054927355 9:70602023-70602045 TTTCTTCTTGACCAATGTTGTGG - Intronic
1057549650 9:96042868-96042890 TTGCTTCCTGACCACTGTGGTGG - Intergenic
1060548261 9:124473283-124473305 TGTCCTTCTGGCCACTGTGCCGG + Intronic
1060756757 9:126219465-126219487 TGGCCTTTTGACCACTTTTGTGG - Intergenic
1061321655 9:129834881-129834903 CGTCCTCTGGACCACTGTGCTGG - Intronic
1061499266 9:130992865-130992887 TGTCCCCTTGCCCACTGGGCTGG - Intergenic
1062224729 9:135443300-135443322 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1185820657 X:3200511-3200533 TTTACTCTTGAACAATGTGGGGG - Intergenic
1185909437 X:3968690-3968712 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1186558769 X:10588731-10588753 TGTTCTCTTAACTACTGTGGGGG + Intronic
1188064239 X:25637994-25638016 TGTCTTCTTGTCCAATTTGGAGG - Intergenic
1188191390 X:27175179-27175201 TATCATTTTGACCTCTGTGGGGG + Intergenic
1189550081 X:42083775-42083797 TTACCTCTTAACCACTGTTGAGG + Intergenic
1190315455 X:49147684-49147706 TGTCCTCTTAACCACTGTAGGGG + Intergenic
1190426368 X:50337420-50337442 TGTCCTCTTAACCACTGTGGGGG + Intronic
1190771006 X:53513959-53513981 TGTTTTCTCAACCACTGTGGTGG - Intergenic
1191036532 X:56030891-56030913 TGTCCTGTTAACCACTGTGGGGG + Intergenic
1191918176 X:66224983-66225005 TGCTCTCTCAACCACTGTGGTGG + Intronic
1193069670 X:77294834-77294856 TGCCCTCTTAACCACTGAGGGGG - Intergenic
1194399986 X:93430979-93431001 TGCCCTCTTAGCCACTGCGGGGG - Intergenic
1196460300 X:115922931-115922953 TGTTCTCTCAACCACCGTGGGGG + Intergenic
1200394611 X:155976398-155976420 TGTCCTCTTAACCACTGTCGGGG + Intergenic
1200925113 Y:8647407-8647429 TGACCTCTTAACTACTGTGGAGG - Intergenic
1200932964 Y:8713961-8713983 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1200942916 Y:8804277-8804299 TGTCCTCTTAACTACTGTGGGGG - Intergenic
1200947812 Y:8864050-8864072 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1200984068 Y:9287804-9287826 TGTCCTCTTCACCACTGTGCAGG + Intergenic
1201260265 Y:12152525-12152547 TGTTCTCTCAACCACTGTGAGGG + Intergenic
1201270195 Y:12246769-12246791 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1201537545 Y:15067479-15067501 TGTCATGTTGACCACTGAGCTGG - Intergenic
1201680995 Y:16643493-16643515 TGTCCCCTTAACCACTGCAGGGG + Intergenic
1202126380 Y:21572438-21572460 TGTCCTCTTAACCACTGTGCAGG - Intergenic
1202152619 Y:21856966-21856988 TATCCTCTTAATCACTGTGCAGG + Intergenic