ID: 918650992

View in Genome Browser
Species Human (GRCh38)
Location 1:186962920-186962942
Sequence GATTCCAAGCCAGGTTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918650992 Original CRISPR GATTCCAAGCCAGGTTCACA AGG (reversed) Intronic
900591580 1:3462639-3462661 GATTCCAGGCCAGGTCTTCAGGG + Intronic
902599144 1:17529427-17529449 GACCCCAAGCCAGCTTCTCAGGG + Intergenic
904481906 1:30799252-30799274 GATTTCAAGCCAGGGTCATCTGG + Intergenic
905871093 1:41405040-41405062 GATTCAAACCCAGGTCCACCTGG + Intergenic
913157064 1:116110262-116110284 TATTACAAGTCAGGTTAACAAGG - Intergenic
915533939 1:156522999-156523021 GATTACAGGCCAGGGTCACTGGG - Intergenic
917010363 1:170464214-170464236 GATCCCACGCCTGGTTCAGAGGG + Intergenic
918219108 1:182419356-182419378 GATTCAAAGCCAGGTCCAGCTGG - Intergenic
918650992 1:186962920-186962942 GATTCCAAGCCAGGTTCACAAGG - Intronic
920683341 1:208090089-208090111 GATTCCCAGCGAGGTTGCCAGGG - Intronic
923122817 1:231009319-231009341 GATTCCAAGACAGGTTTTCTAGG - Intergenic
923455751 1:234163778-234163800 GAATCAAAGTCAGGTTCACAGGG - Intronic
1063584330 10:7337784-7337806 GATTCCAGGGCAGGTACAGAGGG - Intronic
1064601991 10:17003375-17003397 GATTCTAGCGCAGGTTCACAGGG - Intronic
1065856303 10:29833000-29833022 GATTCCCAGCCAAATTCAGATGG - Intergenic
1067448773 10:46368704-46368726 GATTCCAAGCCTGCTGCTCAAGG - Intergenic
1067588599 10:47492061-47492083 GATTCCAAGCCTGCTGCTCAAGG + Intergenic
1067635725 10:48000152-48000174 GATTCCAAGCCTGCTGCTCAAGG + Intergenic
1070132285 10:73664159-73664181 GATTCCAAGCCTGCTGCTCAAGG + Intergenic
1070410423 10:76134309-76134331 TATTTCAAGCCATGTTCCCAAGG + Intronic
1071176406 10:82931433-82931455 GATCCCAAGACAGCTTCCCAAGG - Intronic
1071609395 10:87019917-87019939 GATTCCAAGCCTGCTGCTCAAGG - Intergenic
1072448327 10:95518737-95518759 CATTCCAAGCCAGTTTCAGGGGG - Intronic
1074471966 10:113735502-113735524 GATTCCAAGAGAGGTTCCAAAGG + Intergenic
1074507099 10:114080908-114080930 GATTCCAGGCCAGTCTCACCGGG + Intergenic
1076294031 10:129370061-129370083 TTTTAAAAGCCAGGTTCACATGG + Intergenic
1079380160 11:19931245-19931267 GATTCCAAGCCAGTCTCCCCAGG + Intronic
1079469170 11:20762113-20762135 TGTTTCAAGCCAGGTTCATATGG + Intronic
1080950445 11:37026311-37026333 CATTCCATATCAGGTTCACACGG - Intergenic
1081115422 11:39193232-39193254 GATTCAAACCCAGGTCCACCTGG - Intergenic
1082959807 11:58907342-58907364 GATTCCAGGCCAGTGTCGCAAGG - Intronic
1082975342 11:59064773-59064795 GATTCCAGGCCAGTGTCGCAAGG - Intergenic
1083383480 11:62288577-62288599 GAACCAAAGCCAGGTTCTCATGG + Intergenic
1091837548 12:3596233-3596255 GATTCCAGGCCAGGTGAACACGG - Intergenic
1092729617 12:11517220-11517242 GATTACAAGCCAGTGTCACCAGG + Intergenic
1095102011 12:38195029-38195051 GATTAGAAGCCAAGCTCACAAGG + Intergenic
1097789191 12:63796071-63796093 GTTTCCAATCCAGAATCACACGG + Intronic
1099065549 12:77973791-77973813 TAATTGAAGCCAGGTTCACAAGG - Intronic
1102086336 12:110143940-110143962 AATTCCAAGGCAGGTATACAAGG - Intronic
1106002377 13:25736386-25736408 GATTCCTACCCAGGAACACAGGG - Intronic
1106080179 13:26493848-26493870 GATGCCAAGCCAGGTACAGCAGG - Intergenic
1107668148 13:42714398-42714420 TATTTAAAGCCAGGTTTACAAGG + Intergenic
1112238772 13:97660565-97660587 GATTCCAAGCCAGGTCACAACGG - Intergenic
1113237668 13:108298737-108298759 GAGGCCAAGGCAGGATCACAAGG + Intronic
1115361552 14:32509054-32509076 GAGGCCAAGGCAGGATCACAAGG - Intronic
1115512268 14:34149360-34149382 GATTCCAATCCAGCTTCACAGGG - Intronic
1116795029 14:49380890-49380912 GATTCCAGTCCAGATTGACATGG - Intergenic
1119079785 14:71681662-71681684 TTTTCCAAGCCAGAGTCACATGG + Intronic
1119560280 14:75584132-75584154 CATTCGAAGCAAGGTCCACAAGG + Intronic
1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG + Intergenic
1120181075 14:81342811-81342833 GAGTCCAAGCCAGGGTCTGAGGG + Intronic
1122808831 14:104277638-104277660 GTTTCCAAACCAGGCTCTCATGG - Intergenic
1125114324 15:36071393-36071415 AATTCCAATCCAGTTCCACAGGG - Intergenic
1129884116 15:79026744-79026766 ACTTCCAAGCCAGGTCCACTTGG + Intronic
1130675740 15:85950398-85950420 GATCCTAAGCTGGGTTCACATGG + Intergenic
1133150101 16:3821647-3821669 CAATCCAAGCCAACTTCACACGG + Intronic
1134241151 16:12507993-12508015 GATTTGAACCCAGGTCCACACGG - Intronic
1137254544 16:46764173-46764195 GATTCCAAGCTAGGGCAACATGG + Intronic
1139286700 16:65821744-65821766 CATTCCAAGTCAGGTTCCCTGGG + Intergenic
1140666958 16:77236449-77236471 AATTCCAAGCAAGGTTCAGAAGG + Intergenic
1141623565 16:85249736-85249758 GACTCCAAGCCAGGCCCTCAGGG - Intergenic
1141892898 16:86939001-86939023 GACTCCAACCCAGGTTCATCTGG - Intergenic
1143268763 17:5660082-5660104 GATTCCAATCCACATCCACAGGG + Intergenic
1144888306 17:18478563-18478585 GTTTCCAAGCCAGGCCCTCATGG - Intronic
1145143900 17:20465739-20465761 GTTTCCAAGCCAGGCCCTCATGG + Intronic
1145791975 17:27632954-27632976 GTTTCCAAGCCAGGCCCTCATGG - Intronic
1148800012 17:50218869-50218891 GATTTTTAGCCAGCTTCACATGG - Intergenic
1152676430 17:81643760-81643782 CATTCCAATCCAGTTTCACCAGG - Intronic
1153373473 18:4348353-4348375 GATTCCAGTCCAGCATCACAGGG - Intronic
1154210587 18:12376182-12376204 GAGGCCAAGCCAGGTTCCCGTGG + Intronic
1155256346 18:24001273-24001295 GAACCCAAGCCAGGTTGACCTGG - Intronic
1155535059 18:26808530-26808552 AATGCAAAGCCAGATTCACAGGG - Intergenic
1155850769 18:30770756-30770778 GATTCCAAGTCAAGCTCCCAAGG - Intergenic
1155911215 18:31506168-31506190 GAATCAAACCCAGGTTCACCTGG + Intronic
1156644886 18:39148874-39148896 GAATTCAGGCCAGGTTCAAAAGG - Intergenic
1157556425 18:48615812-48615834 GCTGCCCAGCCAGATTCACATGG - Intronic
1157567546 18:48689869-48689891 GACTGCAAGCCAGATTCACTCGG - Intronic
1164752617 19:30667982-30668004 GATTTGAAGCCAGGTCCTCAGGG + Intronic
1168464482 19:56590405-56590427 GATCCCAAGGGAGGTTCAGAAGG - Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
927714731 2:25344050-25344072 GATTCAAAGCCAGGTTCATCCGG + Intergenic
929411803 2:41705091-41705113 GATTGCAAGCCAGGTTGATGGGG + Intergenic
930134942 2:47892950-47892972 AATTACCAGCCTGGTTCACATGG + Intronic
930773971 2:55154749-55154771 GATTGTAAGCCAGGCTCACCTGG - Intergenic
931848346 2:66228251-66228273 GATTCCAAGTCTAGTGCACAAGG - Intergenic
932052710 2:68414946-68414968 GATTCAAATCCAGGTCCACCTGG + Intergenic
933862305 2:86482341-86482363 GATTCCAAGCCAGGACCCCCAGG - Intronic
933992563 2:87643970-87643992 GATTCTAAGGCAGGAGCACATGG - Intergenic
935600040 2:104913325-104913347 GATTCCCATCCAGATTCTCAGGG + Intergenic
936301290 2:111306871-111306893 GATTCTAAGGCAGGAGCACATGG + Intergenic
937151229 2:119687286-119687308 GATTCTATTCCAGGCTCACACGG - Intergenic
939192120 2:138929327-138929349 TAATCCAAGACAGTTTCACAAGG - Intergenic
939326793 2:140701764-140701786 GACTCCAAGGCCGGTTCTCATGG + Exonic
942499052 2:176568992-176569014 GGTTCTAAGCCAGGTTCATGAGG - Intergenic
944126140 2:196294851-196294873 CATTCCAAGTCAGGTTATCAGGG - Intronic
944707379 2:202304797-202304819 GATTTCAAACTAAGTTCACAAGG - Intergenic
945887261 2:215389302-215389324 CAGTCCAAGCCTGGTTAACACGG - Intronic
1169985606 20:11440619-11440641 GCTTCCAAGCCCGGGTCTCAAGG - Intergenic
1171127456 20:22614979-22615001 GATCCAAAGGCTGGTTCACAGGG + Intergenic
1172009102 20:31836185-31836207 GAGCCCAAGCCAGGTTCCCCAGG - Intergenic
1172155718 20:32822742-32822764 GATTTCAAGCCAGGAGGACATGG - Intronic
1178360250 21:31943330-31943352 TATTCCAAAACAGGTTCACTTGG + Intronic
1179032195 21:37730331-37730353 GATTCCAACCCAGGCCCACCAGG - Intronic
1181112284 22:20609247-20609269 GATCCCAGGCCAGGATCAGAGGG - Intergenic
1182112267 22:27732289-27732311 GAGTTCAAGCCAGGTTTGCATGG + Intergenic
1182283734 22:29232243-29232265 GATTCCATTGCAGGTCCACAGGG + Exonic
1183034148 22:35128113-35128135 GATTCAAACTCAGGTTCAGATGG + Intergenic
1183647081 22:39133130-39133152 GTTTCTAACCCAGGTTCGCAAGG + Exonic
952904690 3:38132041-38132063 AATTCCATGCCAGGCTCTCATGG + Intronic
957165929 3:76674027-76674049 CATTCAAAGCCACGTTCAGAGGG - Intronic
958598953 3:96268471-96268493 TATTCCTATCCAGGTTTACAGGG + Intergenic
960454016 3:117847702-117847724 GTTTAAAAGCCAGGTTAACAGGG + Intergenic
961406374 3:126682454-126682476 GATTTGAAACCAGGTCCACATGG - Intergenic
964081916 3:152769025-152769047 GATTCCCTGCCAGGTTCATCTGG - Intergenic
965732609 3:171788363-171788385 AAAACCAAGCCAGGTTCACAAGG + Intronic
968026433 3:195446450-195446472 GTATGCAAACCAGGTTCACAGGG - Intergenic
973681767 4:53327781-53327803 AATTCTAAGCCAGCATCACAAGG - Intronic
977451019 4:97198161-97198183 GATTGCATGCCAGGTGCAAAGGG - Intronic
978379980 4:108116713-108116735 GATTCACACCCAGGTTCACCAGG - Intronic
979202671 4:117997251-117997273 GATTCCAGGCCAGGGACAGAAGG - Intergenic
979492130 4:121339979-121340001 GACTCCAAGCCAAGCTAACAAGG - Intronic
981011309 4:139928121-139928143 GATTCCAATCCAACATCACAGGG + Intronic
981175727 4:141681006-141681028 GATACAAAGCCAGGATGACATGG - Intronic
983833003 4:172353684-172353706 GATTTTATGCCAAGTTCACAAGG + Intronic
988302920 5:29455390-29455412 GATTTCAAGCCAGCTCCATATGG + Intergenic
988531597 5:32032349-32032371 GATTCCGAGGCAGATTCTCAGGG - Intronic
992929509 5:81628195-81628217 GAATCCATGGCAGATTCACATGG + Intronic
995074690 5:107968767-107968789 GACTCCAAGCAAGGTTCATAAGG - Intronic
999664293 5:153896649-153896671 CTTTCCAAGCAAGGTTCAGAGGG - Intergenic
1000147222 5:158465217-158465239 GATTCAAAGCCAGGTATAAATGG - Intergenic
1004990986 6:21138440-21138462 TTTTCCAAGCCAGGTTCACTTGG - Intronic
1012219786 6:96635243-96635265 GAGCCCCAGCCAGCTTCACAGGG + Intergenic
1014580695 6:123133723-123133745 TATTACAACCCAGTTTCACAGGG - Intergenic
1015004838 6:128266710-128266732 GAATCCAAGCAAAGCTCACAGGG + Intronic
1023681035 7:42687328-42687350 GATTCAGAGCCAGATTCACTTGG + Intergenic
1024419549 7:49147603-49147625 GATTTCATGCCAGGAACACAGGG + Intergenic
1024762895 7:52621631-52621653 GAATCCAACCCAGGTTATCATGG + Intergenic
1030190574 7:106806510-106806532 GATTACAAGTCAGGTCAACAAGG - Intergenic
1032372673 7:131374433-131374455 GATTCTAATCCAGTATCACAGGG + Intronic
1033399352 7:141007219-141007241 GATTTGAACCCAGGTTCACATGG - Intronic
1034353345 7:150431628-150431650 CATTCCAAAACAGTTTCACAGGG + Intergenic
1036178803 8:6565840-6565862 GAGTCCATGCCAGCTGCACATGG - Intronic
1039842930 8:41306759-41306781 GGTTCCAAGCCAGGCTGAGAAGG + Intronic
1040320684 8:46296887-46296909 GATCACAAGGCAGTTTCACAGGG + Intergenic
1042169107 8:65975265-65975287 CATTACAAGCCAGGGTGACAGGG + Intergenic
1046574764 8:116013563-116013585 AATTCCAATCCAGAATCACAAGG + Intergenic
1047213975 8:122862279-122862301 GATCCAAAGCCACGTTCACGTGG - Intronic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1052719992 9:32162794-32162816 GGTTCCAAGCCAAGTTCTCCAGG - Intergenic
1052832679 9:33228850-33228872 GATGCCAAGCTGGGGTCACATGG + Intronic
1055910047 9:81339692-81339714 AATTCTAAGGCATGTTCACATGG - Intergenic
1057245231 9:93449897-93449919 TAACCCAAGGCAGGTTCACAAGG - Intronic
1059508290 9:114819867-114819889 GATTCCAAGTCAGGTCCACCTGG - Intergenic
1059793163 9:117662768-117662790 GCTTCCAAGTCAGCTCCACAGGG - Intergenic
1060278195 9:122198085-122198107 GATTCCAACCAAGGTTCACCAGG - Intronic
1186881566 X:13871878-13871900 GATTCCAAGGAAGGGTGACAGGG + Intronic
1190430806 X:50376262-50376284 GAGTCCAAGTCAGGTACCCAGGG - Intronic
1191781999 X:64879028-64879050 TATTCCACGCCTGGCTCACAGGG + Intergenic
1192249892 X:69403194-69403216 GATTCCAGGTAAGGTTCACTGGG + Intergenic
1194644775 X:96446355-96446377 AATTCCAAGGCAGGCTCACAAGG - Intergenic
1198747921 X:139908861-139908883 GTTTCCAATGCAGGCTCACATGG + Intronic