ID: 918652286

View in Genome Browser
Species Human (GRCh38)
Location 1:186980118-186980140
Sequence TTTTGTGTTTGTAGTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240718
Summary {0: 1, 1: 14, 2: 779, 3: 20710, 4: 219214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918652279_918652286 24 Left 918652279 1:186980071-186980093 CCGAGTAGCTGGGACTACAGGCG 0: 42478
1: 106370
2: 174364
3: 132619
4: 206690
Right 918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG 0: 1
1: 14
2: 779
3: 20710
4: 219214
918652283_918652286 -6 Left 918652283 1:186980101-186980123 CCACGCCCGGCTAATTTTTTTGT 0: 3564
1: 14068
2: 39441
3: 126663
4: 236572
Right 918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG 0: 1
1: 14
2: 779
3: 20710
4: 219214
918652276_918652286 28 Left 918652276 1:186980067-186980089 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG 0: 1
1: 14
2: 779
3: 20710
4: 219214
918652282_918652286 -3 Left 918652282 1:186980098-186980120 CCACCACGCCCGGCTAATTTTTT 0: 18690
1: 77643
2: 169590
3: 238539
4: 176060
Right 918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG 0: 1
1: 14
2: 779
3: 20710
4: 219214
918652281_918652286 1 Left 918652281 1:186980094-186980116 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG 0: 1
1: 14
2: 779
3: 20710
4: 219214
918652278_918652286 25 Left 918652278 1:186980070-186980092 CCCGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG 0: 1
1: 14
2: 779
3: 20710
4: 219214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918652286 Original CRISPR TTTTGTGTTTGTAGTGAAGA CGG Intronic
Too many off-targets to display for this crispr