ID: 918657235

View in Genome Browser
Species Human (GRCh38)
Location 1:187043308-187043330
Sequence CTGAATATATAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918657231_918657235 10 Left 918657231 1:187043275-187043297 CCAAGTTATATCCAAGTTATGGA No data
Right 918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG No data
918657229_918657235 23 Left 918657229 1:187043262-187043284 CCAAGGAAAAAATCCAAGTTATA No data
Right 918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG No data
918657232_918657235 -1 Left 918657232 1:187043286-187043308 CCAAGTTATGGATAATGAGAGCC No data
Right 918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918657235 Original CRISPR CTGAATATATAAATGGACAA TGG Intergenic
No off target data available for this crispr