ID: 918659949

View in Genome Browser
Species Human (GRCh38)
Location 1:187075210-187075232
Sequence AGGTGTGGTCATGGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918659949_918659956 9 Left 918659949 1:187075210-187075232 CCTTCTACTCCATGACCACACCT No data
Right 918659956 1:187075242-187075264 GTGATCCAGGAAACGTAGTCTGG No data
918659949_918659954 -4 Left 918659949 1:187075210-187075232 CCTTCTACTCCATGACCACACCT No data
Right 918659954 1:187075229-187075251 ACCTAGGAACAAGGTGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918659949 Original CRISPR AGGTGTGGTCATGGAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr