ID: 918661009

View in Genome Browser
Species Human (GRCh38)
Location 1:187088995-187089017
Sequence AACTTTGAAGTGCTAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918661009_918661011 29 Left 918661009 1:187088995-187089017 CCTGTGACTAGCACTTCAAAGTT No data
Right 918661011 1:187089047-187089069 CTATAAATTTCCCTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918661009 Original CRISPR AACTTTGAAGTGCTAGTCAC AGG (reversed) Intergenic
No off target data available for this crispr