ID: 918661117

View in Genome Browser
Species Human (GRCh38)
Location 1:187090224-187090246
Sequence TAAATCTGTATCCGCAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918661117_918661119 17 Left 918661117 1:187090224-187090246 CCTGGATTGCGGATACAGATTTA No data
Right 918661119 1:187090264-187090286 ATGTTAACTGAAGCCATAGAGGG No data
918661117_918661118 16 Left 918661117 1:187090224-187090246 CCTGGATTGCGGATACAGATTTA No data
Right 918661118 1:187090263-187090285 GATGTTAACTGAAGCCATAGAGG No data
918661117_918661120 24 Left 918661117 1:187090224-187090246 CCTGGATTGCGGATACAGATTTA No data
Right 918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918661117 Original CRISPR TAAATCTGTATCCGCAATCC AGG (reversed) Intergenic
No off target data available for this crispr