ID: 918661120

View in Genome Browser
Species Human (GRCh38)
Location 1:187090271-187090293
Sequence CTGAAGCCATAGAGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918661117_918661120 24 Left 918661117 1:187090224-187090246 CCTGGATTGCGGATACAGATTTA No data
Right 918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918661120 Original CRISPR CTGAAGCCATAGAGGGAGAG AGG Intergenic
No off target data available for this crispr