ID: 918661654

View in Genome Browser
Species Human (GRCh38)
Location 1:187095775-187095797
Sequence ACTTGAGGGGGCAATCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918661654_918661660 4 Left 918661654 1:187095775-187095797 CCACCTAGATTGCCCCCTCAAGT No data
Right 918661660 1:187095802-187095824 AGCATGCATTCATCAGATGCTGG No data
918661654_918661661 5 Left 918661654 1:187095775-187095797 CCACCTAGATTGCCCCCTCAAGT No data
Right 918661661 1:187095803-187095825 GCATGCATTCATCAGATGCTGGG No data
918661654_918661663 30 Left 918661654 1:187095775-187095797 CCACCTAGATTGCCCCCTCAAGT No data
Right 918661663 1:187095828-187095850 TATTGACTGCTGATAGATGGTGG No data
918661654_918661662 27 Left 918661654 1:187095775-187095797 CCACCTAGATTGCCCCCTCAAGT No data
Right 918661662 1:187095825-187095847 GAGTATTGACTGCTGATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918661654 Original CRISPR ACTTGAGGGGGCAATCTAGG TGG (reversed) Intergenic
No off target data available for this crispr