ID: 918663023

View in Genome Browser
Species Human (GRCh38)
Location 1:187113219-187113241
Sequence GTAGAGAAGGACAATGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918663023_918663029 16 Left 918663023 1:187113219-187113241 CCCATACCATTGTCCTTCTCTAC No data
Right 918663029 1:187113258-187113280 TATCTGTAGATTGTCAGTCATGG No data
918663023_918663030 17 Left 918663023 1:187113219-187113241 CCCATACCATTGTCCTTCTCTAC No data
Right 918663030 1:187113259-187113281 ATCTGTAGATTGTCAGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918663023 Original CRISPR GTAGAGAAGGACAATGGTAT GGG (reversed) Intergenic
No off target data available for this crispr