ID: 918666844

View in Genome Browser
Species Human (GRCh38)
Location 1:187161989-187162011
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918666844_918666845 -6 Left 918666844 1:187161989-187162011 CCAGGCATGGTTTTAAGTGCTTT No data
Right 918666845 1:187162006-187162028 TGCTTTATATTCAATTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918666844 Original CRISPR AAAGCACTTAAAACCATGCC TGG (reversed) Intergenic