ID: 918666845 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:187162006-187162028 |
| Sequence | TGCTTTATATTCAATTGCTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918666844_918666845 | -6 | Left | 918666844 | 1:187161989-187162011 | CCAGGCATGGTTTTAAGTGCTTT | No data | ||
| Right | 918666845 | 1:187162006-187162028 | TGCTTTATATTCAATTGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918666845 | Original CRISPR | TGCTTTATATTCAATTGCTT TGG | Intergenic | ||