ID: 918668532

View in Genome Browser
Species Human (GRCh38)
Location 1:187182546-187182568
Sequence CTTGATACTCAAATCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918668527_918668532 10 Left 918668527 1:187182513-187182535 CCTCCCAAGCTCATTCTATGAGG No data
Right 918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG No data
918668530_918668532 6 Left 918668530 1:187182517-187182539 CCAAGCTCATTCTATGAGGCTAG No data
Right 918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG No data
918668529_918668532 7 Left 918668529 1:187182516-187182538 CCCAAGCTCATTCTATGAGGCTA No data
Right 918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918668532 Original CRISPR CTTGATACTCAAATCAAACA AGG Intergenic
No off target data available for this crispr