ID: 918668962

View in Genome Browser
Species Human (GRCh38)
Location 1:187188939-187188961
Sequence GTAAAAATTTTCAGTGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918668962_918668966 17 Left 918668962 1:187188939-187188961 CCAAATGCACTGAAAATTTTTAC No data
Right 918668966 1:187188979-187189001 TCTCCAATTTGGCAATGAACAGG No data
918668962_918668963 6 Left 918668962 1:187188939-187188961 CCAAATGCACTGAAAATTTTTAC No data
Right 918668963 1:187188968-187188990 AAATCCCAATCTCTCCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918668962 Original CRISPR GTAAAAATTTTCAGTGCATT TGG (reversed) Intergenic
No off target data available for this crispr