ID: 918668966

View in Genome Browser
Species Human (GRCh38)
Location 1:187188979-187189001
Sequence TCTCCAATTTGGCAATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918668962_918668966 17 Left 918668962 1:187188939-187188961 CCAAATGCACTGAAAATTTTTAC No data
Right 918668966 1:187188979-187189001 TCTCCAATTTGGCAATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918668966 Original CRISPR TCTCCAATTTGGCAATGAAC AGG Intergenic
No off target data available for this crispr