ID: 918686282

View in Genome Browser
Species Human (GRCh38)
Location 1:187419747-187419769
Sequence GTTAGTTTGGAACACGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918686282_918686286 -1 Left 918686282 1:187419747-187419769 CCTTTAACGTGTTCCAAACTAAC No data
Right 918686286 1:187419769-187419791 CCATCAGTAATTATAGGCAGAGG No data
918686282_918686287 0 Left 918686282 1:187419747-187419769 CCTTTAACGTGTTCCAAACTAAC No data
Right 918686287 1:187419770-187419792 CATCAGTAATTATAGGCAGAGGG No data
918686282_918686288 23 Left 918686282 1:187419747-187419769 CCTTTAACGTGTTCCAAACTAAC No data
Right 918686288 1:187419793-187419815 ATTAGATAATAAATCAGTCAAGG No data
918686282_918686284 -7 Left 918686282 1:187419747-187419769 CCTTTAACGTGTTCCAAACTAAC No data
Right 918686284 1:187419763-187419785 AACTAACCATCAGTAATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918686282 Original CRISPR GTTAGTTTGGAACACGTTAA AGG (reversed) Intergenic
No off target data available for this crispr