ID: 918689355 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:187461185-187461207 |
| Sequence | CAGTAGTTTAGGAGATGATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918689355_918689360 | 28 | Left | 918689355 | 1:187461185-187461207 | CCATATCATCTCCTAAACTACTG | No data | ||
| Right | 918689360 | 1:187461236-187461258 | TGAACTGTGATGTTTGGTGCTGG | No data | ||||
| 918689355_918689359 | 22 | Left | 918689355 | 1:187461185-187461207 | CCATATCATCTCCTAAACTACTG | No data | ||
| Right | 918689359 | 1:187461230-187461252 | ACTGATTGAACTGTGATGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918689355 | Original CRISPR | CAGTAGTTTAGGAGATGATA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||