ID: 918689355

View in Genome Browser
Species Human (GRCh38)
Location 1:187461185-187461207
Sequence CAGTAGTTTAGGAGATGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918689355_918689360 28 Left 918689355 1:187461185-187461207 CCATATCATCTCCTAAACTACTG No data
Right 918689360 1:187461236-187461258 TGAACTGTGATGTTTGGTGCTGG No data
918689355_918689359 22 Left 918689355 1:187461185-187461207 CCATATCATCTCCTAAACTACTG No data
Right 918689359 1:187461230-187461252 ACTGATTGAACTGTGATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918689355 Original CRISPR CAGTAGTTTAGGAGATGATA TGG (reversed) Intergenic
No off target data available for this crispr