ID: 918692596

View in Genome Browser
Species Human (GRCh38)
Location 1:187500498-187500520
Sequence TTATCTCCTTTGTTTAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918692595_918692596 -3 Left 918692595 1:187500478-187500500 CCTGGGTGGAAGCAATATCATTA No data
Right 918692596 1:187500498-187500520 TTATCTCCTTTGTTTAGATAAGG No data
918692593_918692596 2 Left 918692593 1:187500473-187500495 CCAACCCTGGGTGGAAGCAATAT No data
Right 918692596 1:187500498-187500520 TTATCTCCTTTGTTTAGATAAGG No data
918692589_918692596 26 Left 918692589 1:187500449-187500471 CCACACACTCTTTTAATTCTCAT No data
Right 918692596 1:187500498-187500520 TTATCTCCTTTGTTTAGATAAGG No data
918692594_918692596 -2 Left 918692594 1:187500477-187500499 CCCTGGGTGGAAGCAATATCATT No data
Right 918692596 1:187500498-187500520 TTATCTCCTTTGTTTAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918692596 Original CRISPR TTATCTCCTTTGTTTAGATA AGG Intergenic
No off target data available for this crispr