ID: 918693174

View in Genome Browser
Species Human (GRCh38)
Location 1:187508293-187508315
Sequence GTGTCAACTTGCCTGTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918693172_918693174 0 Left 918693172 1:187508270-187508292 CCAACCATGAGGGTTAATTTTAT No data
Right 918693174 1:187508293-187508315 GTGTCAACTTGCCTGTGTTAAGG No data
918693173_918693174 -4 Left 918693173 1:187508274-187508296 CCATGAGGGTTAATTTTATGTGT No data
Right 918693174 1:187508293-187508315 GTGTCAACTTGCCTGTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918693174 Original CRISPR GTGTCAACTTGCCTGTGTTA AGG Intergenic