ID: 918694014

View in Genome Browser
Species Human (GRCh38)
Location 1:187520071-187520093
Sequence AAGTTCTCATTGATCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918694012_918694014 -8 Left 918694012 1:187520056-187520078 CCTGTAGTTAATTTCAAGTTCTC No data
Right 918694014 1:187520071-187520093 AAGTTCTCATTGATCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918694014 Original CRISPR AAGTTCTCATTGATCTTTGG TGG Intergenic
No off target data available for this crispr