ID: 918701067

View in Genome Browser
Species Human (GRCh38)
Location 1:187608594-187608616
Sequence AACCCAAAATTGTTGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918701064_918701067 26 Left 918701064 1:187608545-187608567 CCTAACAATGCAATGCATCTTTA No data
Right 918701067 1:187608594-187608616 AACCCAAAATTGTTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918701067 Original CRISPR AACCCAAAATTGTTGAAGAA AGG Intergenic
No off target data available for this crispr