ID: 918705203

View in Genome Browser
Species Human (GRCh38)
Location 1:187651958-187651980
Sequence CAGTAGAAGCTGAGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918705200_918705203 15 Left 918705200 1:187651920-187651942 CCATGCAGCTAGAAATGCTCATG No data
Right 918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918705203 Original CRISPR CAGTAGAAGCTGAGTGTGGA GGG Intergenic
No off target data available for this crispr