ID: 918705506

View in Genome Browser
Species Human (GRCh38)
Location 1:187656783-187656805
Sequence GCACTTAGAAACTATAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918705506_918705513 16 Left 918705506 1:187656783-187656805 CCCAGTTTATAGTTTCTAAGTGC No data
Right 918705513 1:187656822-187656844 ACAACAGCTCCTTTGATGAATGG No data
918705506_918705508 -9 Left 918705506 1:187656783-187656805 CCCAGTTTATAGTTTCTAAGTGC No data
Right 918705508 1:187656797-187656819 TCTAAGTGCTATCCCCACAAAGG No data
918705506_918705509 -8 Left 918705506 1:187656783-187656805 CCCAGTTTATAGTTTCTAAGTGC No data
Right 918705509 1:187656798-187656820 CTAAGTGCTATCCCCACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918705506 Original CRISPR GCACTTAGAAACTATAAACT GGG (reversed) Intergenic
No off target data available for this crispr