ID: 918708008

View in Genome Browser
Species Human (GRCh38)
Location 1:187692468-187692490
Sequence ATCTATCAACAGTGGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918707998_918708008 27 Left 918707998 1:187692418-187692440 CCTAGGAAAGACTTCAAATGTGG No data
Right 918708008 1:187692468-187692490 ATCTATCAACAGTGGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918708008 Original CRISPR ATCTATCAACAGTGGCTACA GGG Intergenic
No off target data available for this crispr