ID: 918714690

View in Genome Browser
Species Human (GRCh38)
Location 1:187770692-187770714
Sequence CAGAGCAAAGAGCAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918714687_918714690 4 Left 918714687 1:187770665-187770687 CCTAATGTCGTAGGTGGATCTTT No data
Right 918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918714690 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG Intergenic
No off target data available for this crispr