ID: 918715359

View in Genome Browser
Species Human (GRCh38)
Location 1:187779518-187779540
Sequence CTGGGCTTCTAATAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918715351_918715359 28 Left 918715351 1:187779467-187779489 CCTATTGTAACCCACACCAACTA No data
Right 918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG No data
918715357_918715359 -9 Left 918715357 1:187779504-187779526 CCCTCATCTTCTAACTGGGCTTC No data
Right 918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG No data
918715354_918715359 12 Left 918715354 1:187779483-187779505 CCAACTAAGACACACTCTCTTCC No data
Right 918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG No data
918715352_918715359 18 Left 918715352 1:187779477-187779499 CCCACACCAACTAAGACACACTC No data
Right 918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG No data
918715353_918715359 17 Left 918715353 1:187779478-187779500 CCACACCAACTAAGACACACTCT No data
Right 918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG No data
918715358_918715359 -10 Left 918715358 1:187779505-187779527 CCTCATCTTCTAACTGGGCTTCT No data
Right 918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918715359 Original CRISPR CTGGGCTTCTAATAGTGTCC TGG Intergenic
No off target data available for this crispr