ID: 918718118

View in Genome Browser
Species Human (GRCh38)
Location 1:187817989-187818011
Sequence GCCCATGCAGAGTCTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918718118_918718123 19 Left 918718118 1:187817989-187818011 CCCAGCAGAGACTCTGCATGGGC No data
Right 918718123 1:187818031-187818053 CTTCCACACTACCCTAGCAGAGG 0: 27
1: 405
2: 721
3: 1455
4: 1579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918718118 Original CRISPR GCCCATGCAGAGTCTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr