ID: 918718123

View in Genome Browser
Species Human (GRCh38)
Location 1:187818031-187818053
Sequence CTTCCACACTACCCTAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4187
Summary {0: 27, 1: 405, 2: 721, 3: 1455, 4: 1579}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918718119_918718123 18 Left 918718119 1:187817990-187818012 CCAGCAGAGACTCTGCATGGGCA No data
Right 918718123 1:187818031-187818053 CTTCCACACTACCCTAGCAGAGG 0: 27
1: 405
2: 721
3: 1455
4: 1579
918718116_918718123 20 Left 918718116 1:187817988-187818010 CCCCAGCAGAGACTCTGCATGGG No data
Right 918718123 1:187818031-187818053 CTTCCACACTACCCTAGCAGAGG 0: 27
1: 405
2: 721
3: 1455
4: 1579
918718118_918718123 19 Left 918718118 1:187817989-187818011 CCCAGCAGAGACTCTGCATGGGC No data
Right 918718123 1:187818031-187818053 CTTCCACACTACCCTAGCAGAGG 0: 27
1: 405
2: 721
3: 1455
4: 1579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918718123 Original CRISPR CTTCCACACTACCCTAGCAG AGG Intergenic
Too many off-targets to display for this crispr