ID: 918720012

View in Genome Browser
Species Human (GRCh38)
Location 1:187840769-187840791
Sequence TCTTATCTTGACATGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918720012_918720017 16 Left 918720012 1:187840769-187840791 CCTTACACCATGTCAAGATAAGA No data
Right 918720017 1:187840808-187840830 CCTCATACCAGGATCCGTTTAGG No data
918720012_918720015 5 Left 918720012 1:187840769-187840791 CCTTACACCATGTCAAGATAAGA No data
Right 918720015 1:187840797-187840819 ATTCTTACATTCCTCATACCAGG No data
918720012_918720018 22 Left 918720012 1:187840769-187840791 CCTTACACCATGTCAAGATAAGA No data
Right 918720018 1:187840814-187840836 ACCAGGATCCGTTTAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918720012 Original CRISPR TCTTATCTTGACATGGTGTA AGG (reversed) Intergenic
No off target data available for this crispr